1. BioLogic

2. The Project A Bacterial Decoder –Uses biologically modeled ‘logic gates’ to essentially decode functions –Function outputs will rely on specificity of the combination of input(s) –Outputs will be regulated at the transcriptional level

3. AB 0 - No Glucose, No Lactose Glucose/No Glucose 1/0 Lactose/No Lactose 1/0 1 - No Glucose, Lactose 2 - Glucose, No Lactose 3 - Glucose, LactoseCFP BFP YFP GFP inputs output Combinations Bacterial Decoder

4. Glucose Lactose --+ + + + LacO GFP XBS YBS -10 -35 CRPE MiCE CRPE Standard Lac Operon Glycolysis Regulon (?) Lac Operon Type II Lac Operon Type III XY YXYFP YCFP XBFP

5. 2:4 Decoder CRPE- binding site for CRP –CRP- cAMP Receptor Protein (CAP) : bind to cAMP to activate Lac Operon –[cAMP] = 1/[glucose] LacO-Binding site for LacI –LacI- Repressor of Lac genes; inactivated upon binding of allolactose _FP-____ Fluorescent Protein (Green, yellow, blue, cyan) –Protein containing chromophores that fluoresce light at specified wavelengths XBS- Binding Site for X –X- Repressor X YBS- Binding Site for Y –Y- Repressor Y MiCE-Binding site for MiC –MiC- transcriptional activator; responds to [Glucose] The Lac Operon is both independently positively and negatively regulated. This means that not only must the repressor be removed, but an activator must be present http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/L/LacOperon.html

6. Different Constructs Localization of Decoder –Plasmids vs. Genome Transcriptional Molecular Switches found in Biology –Lambda Bacteriophage product coding on both strands of DNA http://books.google.com/books?id=hhrnA-t- sMkC&dq=lambda+bacteriophage&printsec=frontcover&source=in&hl=en&ei =jsH0Sa3RM5iqMuC46LAP&sa=X&oi=book_result&ct=result&resnum=12#P PA33,M1 http://books.google.com/books?id=hhrnA-t- sMkC&dq=lambda+bacteriophage&printsec=frontcover&source=in&hl=en&ei =jsH0Sa3RM5iqMuC46LAP&sa=X&oi=book_result&ct=result&resnum=12#P PA33,M1 –S. Typhimurium Homologous Recombination to disrupt gene coding via invertible switch http://biology.kenyon.edu/BMB/Chime/hinreco/recomast.htm http://biology.kenyon.edu/BMB/Chime/hinreco/recomast.htm

7. PR PRE PRM cIcro oR3oR2oR1 cII cII: Activates at PRE to express cI Cro: Represses at PRM to prevent expression of cI cI: Represses at PR to prevent expression of cro and also lytic genes. Also activates at PRM to continue expression of cI Phage Control Region  Late Lytic Genes *Early in infection, cII and Cro are produced from PR. -If conditions favor cII: This regulator activates expression of cI, a repressor of the “late” lysis genes, from PRE. cI, also called repressor, represses production of Cro from oR2 and oR1 of PR and also “lytic phage genes” from PL resulting in lysogeny. -If conditions don’t favor cII: Cro is expressed from PR. Cro represses expression of cI from oR3 of PRM- allowing expression of lytic phage genes.

8. P-O P P No promoter for fljBA operon No transcription of fljBA No repression of fliC P // hin fljB H2 flagellin fljA Repressor IR P hin fljBfljA P-O Hin Recombinase Invertible Region H1 flagellin Inverted Region fliC Site-specific recombination The Hin Invertible Switch

9. Inspired from MOS logic When either A or B are 5v the respective switch closes, making a connection. If both A and B are 5v V out is connected to ground (0v) The arrows designate whether the connection across the transistor is made when the input voltage (Va and Vb) is at 1 or 0. Building our logic repressors can be used the exact same way as MOS logic. Expandable, effective on all DNA NAND gate

10. Multi-level logic ATTCGATCACAGTACAAAGAGGTTTTA TAAGCTAGTGTCATGTTTCTCCAAAAT ATTCGATCACAGTACAAAGAGGTTTTA TAAGCTAGTGTCATGTTTCTCCAAAAT A’ B B’ Protein X ATTCGATCACAGTACAAAGAGGTTTTA TAAGCTAGTGTCATGTTTCTCCAAAAT ATTCGATCACAGTACAAAGAGGTTTTA TAAGCTAGTGTCATGTTTCTCCAAAAT X B’ X’A’ Z (final output)

11. Logic equivalent A’ B B’ A’ B’ Z

12. Universal Base System works as a decoder chassis –Restriction sites in between coding regions allow for the simply removal or insertions of genes http://books.google.com/books?id=YTxKwWUiBeUC&pg=PT45&dq=res triction+sites http://books.google.com/books?id=YTxKwWUiBeUC&pg=PT45&dq=res triction+sites –Various ‘parts’ may be stored in cDNA expression libraries http://books.google.com/books?id=7C_lCqvkackC&pg=PA287&dq=cDN A+expression+library http://books.google.com/books?id=7C_lCqvkackC&pg=PA287&dq=cDN A+expression+library You choose inputs, you choose outputs

13. Expandable 3:8, 4:16, etc. decoders can be constructed cutting and pasting various parts of negatively and positively regulated operons (Lac) Limited only by the amount of repressors you can add, and the amount of DNA you can introduce into the cell

14. Previous iGEM Projects Davidson-Missouri Western -iGEM 05: created a 3:8 decoder device using anit-swtiches and riboswitches http://openwetware.org/wiki/Davidson:Davidson_2005 http://openwetware.org/wiki/Davidson:Davidson_2005 -iGEM 06: incorporated hin invertible switch in salmonella to solve pancake problems http://openwetware.org/wiki/Davidson:Davidson_iGEM_2006 http://openwetware.org/wiki/Davidson:Davidson_iGEM_2006 -iGEM 07: Used previous work on hin invertible switch to solve the Hamiltonian Path Problem http://parts.mit.edu/igem07/index.php/Davidson_Missouri_W http://parts.mit.edu/igem07/index.php/Davidson_Missouri_W -iGEM 08: Manipulated the lux operon to mimic XOR gates to compute hash functions http://2008.igem.org/Team:Davidson-Missouri_Western http://2008.igem.org/Team:Davidson-Missouri_Western *These guys won Gold every year, as well as a myriad of category prizes*

15. Previous iGEM Projects UNIPV Pavia –iGEM 08: Experimented with mux and demux logic functions in E. Coli using the lux operon http://2008.igem.org/Team:UNIPV-Pavia/Project

16. Previous Works Team in Japan (not affiliated with iGEM) –http://www.sciencenews.org/view/generic/id/3 7724/title/Bacteria_do_Boolean_logic_ –Uses logic gates post translationally to control production of proteins

17. Originality Logic gates to construct a decoder have been implemented in bacteria –An efficient bacterial construct to compute logic functions at the transcriptional level is currently novel. Can we use catabolite activator proteins? –Using CAPs would be more universal/standard (something iGEM strives for) –Operons and thus repressors are different for different genes so each proejct would have to design a new decoder –CAPs work in the opposite way but bind to the promoter. –Not as wide of variety in CAPs?

18. CAPs CAP already well characterized with cAMP Can we find one more? The more CAPs there are, the more expandable this idea is If input is 11 then it will produce 01, 10, and 11 outputs –Pair with repressors http://books.google.com/books?id=17xyknkbAikC&pg=PA59&dq=catabolite +activator+protein http://books.google.com/books?id=MsFkrBY2- 5AC&pg=PA364&dq=catabolite+activator+protein

19. Clocked Memory Introduce a time domain into bacteria Toggle flip-flop –Only stores function when high –Set repressors in certain fashions depending on timing –First clock high green could stop repression of gene A –Second clock high could stop repression of gene B –Express total strand to see stored information Toggle by expressing 2 proteins to change state Detect that protein to determine which repressor to knock out

20. So… …yeah. It seems that the Bacterial Decoder is nothing new. It has been constructed by the Davidson-Missouri Western team in 2005. They’ve spent each succeeding year constructing new logic constructs in E. Coli to solve different problems. Constructing a bacterial decoder that regulates the output at the transcriptional level is currently our only option. D-MW made their decoder regulating at the translational level. A team in Japan (see slide links) made their decoder using post-translational regulation. Things to consider are the pros and cons in transcriptional vs. post- transcriptional regulation. The idea of creating a “universal decoder”- a model decoder in which outputs and inputs may be exchanged with other ‘parts’ would be a novel organism. However since inputs may be of different caliber, and their associated receptors and transcriptional activators extremely specific, the only way this would be a good idea is if we can engineer an operon (sets of operons) and associated regulatory factors that function as a template for all inputs and outputs. This is quite the task because inputs act on different parts of the cell. Inputs like lactose, act on LacI repressors, while inputs such as ions and metals act on cell membrane receptors. With this being said, the task is not impossible, and with a bit of engineering creativity, this model can have a myriad of practical implications.

21. Also…. Another idea, which would also be novel, would be to create not a bacterial cellular decoder, but a bacterial community decoder using quorum molecules of the lux system. If people are interested in this idea, which although is ideologically and conceptually a bit more complex, is easier to construct and has more applications than a single cell decoder, please let me know, and I can explain it in greater detail. It is easier to create cells of specific functions than a single cell that contains all the logic gates of the decoder.