1. Genome Sequencing in the Legumes Le et al. 2007

2. Phylogeny Major sequencing efforts Minor sequencing efforts ~14 MY ~45 MY

3. Zhu et al. 2005

4. Papilionoideae in GenBank

5. Types of sequencing Physical map --> Sequence map –Traditional--human & Arabidopsis Sequence map --> Physical map –Drosophila Incomplete sequence map –With or without physical information

6. Genome..actggtcgtaatgtagttgccctcagfgttagtaatttt attgtagtatgatgt.. ? 150 kb fragments BAC library Physical to Sequence (rice, Arabidopsis, human)

7. fingerprint Integrate genetic physical map

9. Map-based Genome Sequencing Chromosome Genetic map Physical map actggagtggatgaactgactaaactgtaactgtacgatcgtttagctacggcggcgatcgatcgggtcagcacgtagctagctgacgtgggctagctaattatacgatcggagatcgatcgtaatcggatcgatcgcgcggcatctacgatcgatcgtagctagtc Minimum Tiling Path

10. Shotgun sequencing Soybean chromosomes contig scaffold Lots of contigs/scaffolds Not anchored to genetic map

11. Shotgun Genome Sequencing Chromosome Genetic map Physical map shotgun sequence

12. Outcomes Map-based approach –Highly ordered, clone-based, genetically integrated, contiguous sequence (gold standard) –Slower, costly Shotgun approach –Initially disordered, though can be genetically integrated –May or may not have underlying physical map –May have assembly problems –Fast and less expensive

13. Prerequisites Understand genome structure –Neopolyploidy? –Repeat content? –Repeat distribution? –Comparisons to related genomes. How valuable will they be?

14. Leveraging Genomes Understand and introgress diversity Marker development for selection and gene cloning Basic questions: evolution, genome structure

15. Genus Oryza A - O. rufipogon B - O. nivara C - O. glaberrima

16. How to deal with incompletely sequenced genomes Genetic and physical maps/information are imperative Leverage related genomes to aid in assembly Target finishing to regions of interest –Genic/QTLs/anchored scaffolds… Low coverage sequencing of MTP or entire BAC library

18. Doyle and Luckow 2004