1. CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR

2. CHMI 4226E – W20052 PCR Very powerful method Allows for the in-vitro synthesis of a specific DNA molecule from very limited amounts. 3 basic steps (1 PCR cycle): –DNA denaturation –Primer annealing –Extension with DNA polymerase

3. CHMI 4226E – W20053 PCR The increase in the amounts of the DNA on interest is exponential: doubles after each cycle (in theory) Fold increase can be determined as follows: –Increase = 2 n n = number of cycles –So, 25 PCR cycles will give you a theoretical amplification of 34 million fold!!! In reality, a two-fold increase per cycle is rarely, if ever, obtained, due to: –Presence of inhibitors –GC-rich regions in the template.

4. CHMI 4226E – W20054 PCR

5. CHMI 4226E – W20055 PCR - Reagents

6. CHMI 4226E – W20056 PCR-Selecting primers

7. CHMI 4226E – W20057 PCR

8. CHMI 4226E – W20058 PCR

9. CHMI 4226E – W20059 PCR 5’ primer: 5’atg gac ggg tcc ggg gag cag ccc 3 ’ – Coding strand 5’atggacgggtccggggagcagcccagaggcggggggccca3’ 3’tacctgcccaggcccctcgtcgggtctccgccccccgggt5’ 5’atggacgggtccggggagcagcccagaggcggggggccca3’ 5’atggacgggtccggggagcagccc 3’ 3’tacctgcccaggcccctcgtcgggtctccgccccccgggt5 ’ 95 o C, 1 min

10. CHMI 4226E – W200510 PCR

11. CHMI 4226E – W200511 5’ctcaccgcctcgctcaccatctggaagaagatgggctga3’ 3’gagtggcggagcgagtggtagaccttcttctacccgact5’ 3’tggtagaccttcttctacccgact5’ 5’ctcaccgcctcgctcaccatctggaagaagatgggctga3’ 95 o C, 1 min 3’ Primer: 5’acc atc tgg aag aag atg ggc tga3’ Coding strand 3’tgg tag acc ttc ttc tac ccg act5’ Template strand 5’ tca gcc cat ctt ctt cca gat ggt 3’

12. CHMI 4226E – W200512 PCR

13. CHMI 4226E – W200513 PCR Desired properties of PCR primers: –Length: 20-24 nt; –Melting point (Tm) = 50-70 o C Tm= 2(A+T) +4(G+C) T anneal = Tm-4 o C –%GC: 35%-65%; –3’ end is rich in GC (acts as a clamp); –No sequence complementary between or within the two primers; –No significant pairing (even incomplete) to other DNA molecules unrelated to the DNA of interest (perform Blast on primers). More on primer design guidelines: –http://www.premierbiosoft.com /tech_notes/PCR_Primer_Desi gn.html Software and algorithms: –http://www.humgen.nl/primer_ design.html –http://www.biocenter.helsinki.fi /bi/Programs/fastpcr.htm –http://frodo.wi.mit.edu/cgi- bin/primer3/primer3_www.cgi

14. CHMI 4226E – W200514 PCR-Annealing temperature 55 o C50 o C 123123 Primer sets M 603 bp 310 bp 281 bp 234 bp 194 bp 118 bp

15. CHMI 4226E – W200515 PCR – Fidelity of target amplification

16. CHMI 4226E – W200516 PCR-primers

17. CHMI 4226E – W200517 PCR-number of cycles While the yield of amplified product increases with the number of cycles, so is the possibility of: –Amplification of partially related sequences; –Introduction of mutations in the amplified DNA.

18. CHMI 4226E – W200518 PCR-number of cycles

19. CHMI 4226E – W200519 PCR-Effect of Mg +2 Mg 2+ is a co-factor for all DNA polymerases However, don’t forget that: –Primers and dNTPs bind Mg 2+ –Too much Mg 2+ will favor non-specific DNA hybridization So: an optimal DNA concentration must be found for each pair of primers.

20. CHMI 4226E – W200520 PCR-Effect of Mg +2 Stoffel fragment: less heat sensitive and no 5’-3’ exonuclease activity.

21. CHMI 4226E – W200521 PCR-Effect of Mg +2 http://www.promega.com/guides/pcr_guide/070_04/promega.html

22. CHMI 4226E – W200522 PCR-Effect of Mg +2 http://info.med.yale.edu/genetics/ward/tavi/p14.html

23. CHMI 4226E – W200523 PCR- DNA polymerases

24. CHMI 4226E – W200524 PCR- DNA polymerases Processivity: number of nucleotides polymerized before the DNA pol leaves the DNA molecule. Fidelity: accuracy of the enzyme.

25. CHMI 4226E – W200525 PCR- DNA polymerases

26. CHMI 4226E – W200526 PCR- DNA polymerases

27. CHMI 4226E – W200527 PCR- DNA polymerases IMPORTANT: Fidelity and yield are mutually exclusive!

28. CHMI 4226E – W200528 PCR-Plateau effect http://www.biotechlab.northwestern.edu/pe/sld021.htm

29. CHMI 4226E – W200529 PCR-Plateau effect http://www.biotechlab.northwestern.edu/pe/sld021.htm

30. CHMI 4226E – W200530 PCR-Plateau effect Plateau Effect - The plateau effect is an attenuation of the normally exponential rate of product accumulation in a PCR reaction. It can be caused by: –depletion of dNTPs –depletion of primers –stability of the reactants (e.g. enzyme activity; particularly at the denaturation temperature) –end product inhibition by duplex DNA –non-specific competition for resources (production of incorrect product) –reannealing of specific products to one another instead of to the primers (this is particularly problematic when product concentration is high).

31. CHMI 4226E – W200531 Major PCR problem: specificity

32. CHMI 4226E – W200532 Increasing PCR specificity Hot start method http://www.biotechlab.northwestern.edu/pe/sld021.htm

33. CHMI 4226E – W200533 PCR-Specificity

34. CHMI 4226E – W200534 Increasing PCR specificity Use of nested primers Using two sets of primers to amplify a DNA fragment: –A first set of primers is used to amplify a longer piece of the DNA of interest; –A second set of primers is used to amplify a smaller section from the amplified region.

35. CHMI 4226E – W200535 Increasing PCR specificity Touchdown PCR In touchdown PCR, the reaction is first set with an annealing temperature a few degrees (e.g. 5 o C) above the optimal temperature for the primers; During the first few cycles, the annealing temperature is slowly decreased (1 o C per cycle); The aim is to favor the amplification of the DNA of interest over possible competing DNA molecules during the first few cycles of PCR, limiting the amplification of non-specific products in subsequent cycles.

36. CHMI 4226E – W200536 PCR-GC-rich templates Betaine + -

37. CHMI 4226E – W200537 PCR vs DNA cloning

38. CHMI 4226E – W200538

39. CHMI 4226E – W200539

40. CHMI 4226E – W200540

41. CHMI 4226E – W200541 Assignment #4!