Presentation is loading. Please wait.

Presentation is loading. Please wait.

1 Phylogenetic Analyses of Lymphocystis Disease Virus of Fish using Blast and Clustal X Dr. Md. Mosharrof Hossain Associate Professor Department of Zoology.

Similar presentations


Presentation on theme: "1 Phylogenetic Analyses of Lymphocystis Disease Virus of Fish using Blast and Clustal X Dr. Md. Mosharrof Hossain Associate Professor Department of Zoology."— Presentation transcript:

1 1 Phylogenetic Analyses of Lymphocystis Disease Virus of Fish using Blast and Clustal X Dr. Md. Mosharrof Hossain Associate Professor Department of Zoology University of Rajshahi, Bangladesh. mshzool@yahoo.com

2 2 Briefly LCDV research History

3 Family: Iridoviridae Genus: Lymphocystivirus Strains/Species: LCDV-1 (Paralichthys flexus) LCDV-C (Paralichthys olivaceus) LCDV-2 (Limada limanda) LCDV-RF (Sebastes schlegeli ) What is LCDV ? 3

4 AB DC LCDV virus infection 4

5 Objective of Research: 1. To know the biology of LCDV (a) In Vivo, (b) In vitro 2. To find the epitope of infection site 3. To know LCDV taxonomic position 5

6 Materials and Methods 6

7 The Exicycler TM is a Real-Time qPCR system developed by Bioneer. The Exicycler TM is equipped with an optical system that fits above the thermal cycler. It readily utilizes most fluorescent dyes and thus provide wide choices of excitation / emission wavelengths. It can also be used as a standard thermal cycler for general PCR reactions. Experiment-1. PCR 7

8 Principle of PCR 8

9 Target DNA Basics of PCR Heating 95 ℃ Cooling 55 ℃ Polymerase Primer Extension 72 ℃ Cycling 1 Cycle 9

10 The PCR primers were designed according Kitamura et al. (2006) Forward primer LCC-F 5´-CAA GTG TTA CTA GCG CTT T-3´ Reverse primer LCC-R 5´-ATC CCA TTG AAC CGT TCT-3´ Denaturing-94 ℃ -1 min Annealing-54 ℃ - 1 min Extension-72 ℃ -1 min Total PCR reaction mixture was 20 ㎕ A total 30 cycles PCR Condition: Primer design and PCR condition 10

11 DNA transformation, cloning and sequencing: Purified DNA Expression in E. coli Send for sequencing 11

12 Sequences of DNA for analyses 12

13 LCDV Data mining Homology in GENETYX-WIN 5.1 CLUSTAL_X MEGA (NJPLOT) DNA Sequencing analysis 13

14 LCCR- AGCATCTTTATAACCAGAAGTATTTCCACCATTACCACCTGCTGTTATCACTGCTATTGGAGACGTCTTCAATTT AATACTGACATTGGACAAACGACCATAATTGGTAGATCCCATTGGATCTACATCCATCATATTGAGTGAATAGC AATACATGTGATAACCGGTGTCTACAGGAATAGAGCCTCCAAAATAATAAGGTTGAACCAAAGAATAATATT CACTACCCATTTCATTAAGACGAGCACTATTTTCATAAACCAAAGTAACATTTGAAATAGGATCAGCAGCAAT ACCCGGTAAATCGCTAGCAATTCCACCGTCAAAGATTACAGGAGAAGAACTGGTGTAATTGGATTGTATAGC TTGATAGGTAACATTACGCACACCGAAAAAAAGGATTTTAATGGCATGAGAAAATCTGATGTCAAAATTAGG ACTTGGAATAGTTAGAGGTTGAAATACATGTTTAGGTGCTGTTTGTACCTGTTCTACCAAGATGTCTCTAGGT ACTGTACCCATTAAACGACGTTCCTCATTGGTTACTACTACATTAGTAATCCATACTTGCACATCCTTTAAATCA GGTTTACCCCAGTCTAAATCGCCTGCTGTCAAAGGCATGATGGTAGAGTCGTTTTTATTTTGAAAGATCAATA ATTCAGTCCAATCTCTCAGATGAAAAGTTAATCTTATTTCATTATAAGGCAAAGCAGCGCTGGGTAAAGCCAT ACCGCTATCTCGAGAAAAGAAATAAGGTAAAGGAAGTATTAACACTTTTTCAGGTAATTGACCATTGGAATC AACGGGTT LCCF- GCTGTAGCTTATTTTGTACGAGAAACTAAACAATGTACCTGGTTCAGTAAATTACCAGTACTTTTAACACGTTG TTCTGGAACACCTAATTTTGATCAAGAATTTTCTGTCAATGTTTCTCGTGGTGGAGATTATGTACTTAATGCTTG GATGACGGTGCGTATTCCTGCTGTTAAATTGAAAACCAATAATCGTATGAACGCCAATGGTACTATCAGATGGT GTAAAAATTTATTTCATAATTTAGTTAAACAAACTTCTGTTCAATTTAATGATTTAGTTGCTCAAAAATTTGAGA GCTACTTTCTTGATTTTTGGTCCTCTTTTGGTATGTGTGGATCTAAACGTATAGGTTATGATAACATGATAGGTA ATACTATTGATATGACACAACCCGTTGATTCCAATGGTCAATTACCTGAAAAAGTGTTAATACTTCCTTTACCTT ATTTCTTTTCTCGAGATAGCGGTATGGCTTTACCCAGCGCTGCTTTGCCTTATAATGAAATAAGATTAACTTTTC ATCTGAGAGATTGGACTGAATTATTGATCTTTCAAAATAAAAACGACTCTACCATCATGCCTTTGACAGCAGG CGATTTAGACTGGGGTAAACCTGATTTAAAGGATGTGCAAGTATGGATTACTAATGTAGTAGTAACCAATGAG GAACGTCGTTTAATGGGTACAGTACCTAGAGACATCTTGGTAGAACAGGTACAAACAGCACCTAAACATGTAT TTCAACCTCTAACTATTCCAAGTCCTAATTTTGACATCAGATTTTCTCATGCCATTAAAATCC 14

15 15

16 16

17 17

18 18

19 19

20 Homology of MCP genes 20

21 21

22 Cell Line & Virus Inoculation Cells were seeded 1.5×10 5 cells/ ㎖ Overnight confluence Virus injection at 200 ㎕ /wells Cell lines: FFN FSP FHM CHSE-214 RTG-2 Experiment-2. Cell line infection 22

23 M4 8 10 12 16 C P 1347bp PCR detection of LCDV 23

24 Basics of PCR 1 Cycle 2 Cycle 3 Cycle N Cycle ? Ideal graph Real graph Principle of PCR 24

25 Principle of PCR 25

26 Immunofluorescence Test Protocol FFN Cells Seeded in 6-well round plate at 2 x 10 4 cells/chamber Virus inoculation in the wells Washing cells with PBS MAbs treatment for 1h at 37° Microscopy observation Cells Stained with FITC (conjugate) for 1h at 37 ℃ Washing with PBS Washing cells with PBS Mounted with glycerol 26

27 27

28 28

29 LCDV In vivo infection 29

30 LCDV in vivo infection in changing temperature 30

31 Rearing water temperature Days post challenge Detected LCDV dose by PCR (PCR-U mg-tissue -1 * ) FinSkinSpleenKidneyBrainIntestine 10 ℃ 3510 -3 ---- 6010 -3 ---- 20 ℃ 3510 -6 ---- 6010 -6 ---- 30 ℃ 3510 -3 ---- 10 ℃ => 20 ℃ 60+4510 -6 ---- 20 ℃ =>10 ℃ 60+4510 -6 ---- LCDV infection in changing temperature and DNA copies 31

32 LCDV in vitro infection in cell lines 32

33 Fig.4b. Cytopathic effect morphology at the indicated times (upper panel, A,B,C,D) and immunofluorescence of lymphocystis disease virus infected FFN cells (lower panel, E,F,G,H)(×200, Scale bar 50µm). The infected cells showing strong antigen specific fluorescence (arrows) stained with MAbs and secondary antibody FITC goat anti-mouse IgG (Sigma, USA). 33

34 LymphocystivirusRanavirus Megalocytivir us G-IG-IIG-IIIG-IVG-VG-VIEHNV SGIV/G IV G-I (European flounder) 100 78.6- 78.9 81.379.778.980.952 54.7- 54.9 52.6-54.2 G-II (Japanese flounder) 99.6- 100 85.0- 85.2 90.1- 90.3 86.3- 86.7 84.3- 84.9 51.1- 51.7 56.5- 56.9 51-52.6 G-III (Rockfish)10085.884.986.551.7 54.7- 55.2 41.1-52.8 G-IV (Sea bass)10088.284.452 55.6- 55.9 44.2-53.6 G-V (Painted glassfish) 10083.953.8 56.6- 56.7 52.7-54.1 G-VI (Gourami)10050.6 56.8- 57.1 51.6-53.2 EHNV100 69.5- 69.9 56-57.4 SGIV/GIV98.351.5-53.1 Megalocytivirus93.0-100 LCDV genotyping and Homology of MCP gene 34

35 Molecular phylogenetic tree for the relationship among 63 isolates of lymphocystiviruses and other iridoviruses based on the nucleotide sequence of the MCP gene. Bootstrap value 1000. 35

36 Conclusions: 1. LCDV is an opportunistic pathogen that persistently exists in the flounder epidermis at low temperature and outbreaks at suitable temperature. 2. LCDV multiply in the optimum temperature at 20 ℃ when the fish have healthy condition for virus persistence. 3.FFN is susceptible to LCDV, and LCDV is organ- specific both in in vivo & in vitro infections and multiply in fibroblast cells. 4. LCDV isolates from different habitats has the specific viral protein expression patterns and common antigenecity. These antigenic proteins enzymatic activity may help to find an epitope for vaccine preparation. These research published in 1. Hossain M. et al. 2008. Journal of Fish Diseases 31(6): 473–479, doi: 10.1111/j.1365- 2761.2008.00917.x (IF: 1.697 ) 2. Hossain M. et al. 2009. Journal of Fish Diseases 32(8): 699–703, doi: 10.1111/j.1365- 2761.2009.01048.x (IF: 1.697) 3. Hossain M. et al. 2011. Journal of Fish Pathology, 24(2): 47-51. 36

37 37

38 38


Download ppt "1 Phylogenetic Analyses of Lymphocystis Disease Virus of Fish using Blast and Clustal X Dr. Md. Mosharrof Hossain Associate Professor Department of Zoology."

Similar presentations


Ads by Google