1. A Primer for Future Jurors (or Criminals)
DNA Fingerprinting
A Primer for Future Jurors
(or Criminals)
Copyright 2007 John Sayles

2. Genetic Background Only about 10% of our DNA is found in genes
Other 90% is “junk” DNA
DNA that doesn’t code for protein production
This is the stuff that makes us unique
Copyright 2007 John Sayles

3. Uses of DNA Fingerprinting
Forensic cases -- matching suspect with evidence
Paternity testing -- identifying father
Historical investigations
Missing persons investigations
Mass disasters – matching tissue to known DNA to identify victims
Military DNA “dog tag”
Convicted felon DNA databases (CODIS)
Copyright 2007 John Sayles

4. Sources of DNA Evidence (anything containing cells)
Blood
Semen
Saliva
Urine
Hair
Teeth
Bone
Tissue (skin, muscle)
Copyright 2007 John Sayles

5. RFLP Profiling Restriction Fragment Length Polymorphisms
Older technology, but still used
Requires larger sample
Used in OJ, Clinton cases
Copyright 2007 John Sayles

6. RFLP (“rif-lip”)
Restriction Enzymes are used to cut DNA at specific places
RE’s recognize certain base (ATGC) sequences and snip at that location
The fragments are then separated using Electrophoresis
Light chunks move faster
The fragments are exposed to radioactive probes that attach to repeating base sequences
only a small % of RFLP’s are “lit up”
Copyright 2007 John Sayles

7. Example of a RFLP A Restriction Enzyme: RFLP, w/probe:
Copyright 2007 John Sayles

8. Tandem Repeats The probed chunks of DNA contain tandem repeats
… GACTGACTGACTGACTGACT… = [GACT]5
The commonness of these tandem repeats is known
a TR might occur in 10% of the population
By looking for several known TR’s we can narrow likelihood of that combination
Multiply % commonness of each TR
Copyright 2007 John Sayles

9. An Electrophoresis Gel
Negatively charged DNA fragments are attracted to the positive charge on
the right side of the gel. Shorter, lighter DNA fragments travel faster.
Each sample contains many DNA fragments, but only the RFLP’s exposed tothe radioactive probes of repeating TR’s will show up as stripes on the exposed electrophoresis gel.
Copyright 2007 John Sayles

10. Probability Analogy Blood type O was found at a crime scene
The suspect is type O, but so is 50% of the population
Suspect is not excluded, but not proven guilty either
Bruno Magli shoe prints were found at the crime scene
The suspect owns Bruno Magli’s, like 2% of the population
The Bruno Magli’s are size 12’s
The suspect is size 12, like 10% of the population
The % of the population with all three is
50% x 2% x 10% = 0.1% of population = 1 of 1,000
Copyright 2007 John Sayles

11. Calculating TR possible matches in population
3 different TR identified in sample
X = 10% in population
Y = 5% in population
Z = 25% in population
To determine the chance of someone else in population that has this combination of TR just change % into decimal then multiply all together

12. Calculating TR possible matches in population
X = 10% = .10
Y = 5% = .05
Z = 25% = .25
(.10)(.05)(.25) = = .125% chance
Or 1 person in 1000 would match TR

13. Gel Used in Court In a rape case, DNA was tested from:
semen removed from the victim (EVIDENCE #2);
semen left on the victim's clothing (EVIDENCE #1);
the DNA of the victim herself (VICTIM) to be sure that the DNA didn't come from her cells;
DNA from two suspects (SUSPECT #1, SUSPECT #2);
a set of DNA fragments of known and decreasing length (MARKER). They provide a built-in ruler for measuring the exact distance that each fragment travels.
the cells of a previously-tested person to be sure the probes are performing properly (CONTROL).
Who’s guilty?
Who’s not guilty? (ie, who’s excluded?)
Who’s not excluded?
What more would you need to convict suspect 1?
Copyright 2007 John Sayles

14. RFLP Review Restriction Enzymes are used to cut DNA at specific places
RE’s recognize certain base (ATGC) sequences and snip at that location
The fragments are then raced using Electrophoresis
Light chunks move faster
The fragments are exposed to radioactive probes that attach to repeating base sequences
Copyright 2007 John Sayles

15. The Clinton Case
A sample from the “blue dress” was compared to a DNA sample collected from President Clinton
7 different RFLP’s were examined
no expense was spared
The odds of that combination of RFLP’s was 1 in 7.8 trillion
ie, 1 person on 1,000 Earths had that combination. (see text, page 322)
Copyright 2007 John Sayles

16. 7 RFLP “markers” examined
The Restriction Enzyme used
“K” = Known sample
1 in 7.87 trillion Caucasians has this combination of markers
“Q” = Questioned sample
#3243 is the Blue Dress
Document from
Copyright 2007 John Sayles

17. The Simpson Case The Unlucky Sock Found in OJ’s house
Who’s blood is it?
Who’s blood isn’t it?
Would you convict on this alone?
How much more evidence would you need?
DNA Evidence in the O. J. Simpson Trial
Copyright 2007 John Sayles

18. PCR DNA Analysis Polymerase Chain Reaction
Uses DNA polymerase enzyme to amplify DNA in small samples
Can start with a nanogram sample
Can double DNA every two minutes
Billion-fold increase in 1 hour
Fully automated, inexpensive
Copyright 2007 John Sayles

19. STR DNA Analysis Short Tandem Repeats
Same idea as RFLP analysis, but with shorter DNA segments
Better than RFLP
works with much smaller sample
less susceptible to damage or decomposition effects
FBI’s CODIS use 13 STR loci as basis for its analysis technique
Copyright 2007 John Sayles