Presentation is loading. Please wait.

Presentation is loading. Please wait.

PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.

Similar presentations


Presentation on theme: "PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used."— Presentation transcript:

1 PROTEIN SYNTHESIS

2 DNA and Genes

3 DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells

4 Genes & Proteins  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids exist

5 Polypeptides Amino acid chains are called polypeptides

6 DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytoplasm of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER

7 Starting with DNA DNA ‘s code must be copied and taken to the cytosolDNA ‘s code must be copied and taken to the cytosol In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins)In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called PROTEIN SYNTHESISThis process is called PROTEIN SYNTHESIS

8 RNA

9 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan

10 RNA Differs from DNA RNA has a sugar riboseRNA has a sugar ribose DNA has a sugar deoxyribose

11 Other Differences RNA contains the base uracil (U)RNA contains the base uracil (U) DNA has thymine (T) RNA molecule is single-strandedRNA molecule is single-stranded DNA is double- stranded DNA

12 Structure of RNA

13 . Three Types of RNA Messenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomesMessenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized

14 Messenger RNA Long Straight chain of Nucleotides Made in the Nucleus Copies DNA & leaves through nuclear pores Contains the Nitrogen Bases A, G, C, U ( no T )

15 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

16 Ribosomal RNA (rRNA) rRNA is a single strand 100 to 3000 nucleotides longrRNA is a single strand 100 to 3000 nucleotides long Globular in shapeGlobular in shape Made inside the nucleus of a cellMade inside the nucleus of a cell Associates with proteins to form ribosomesAssociates with proteins to form ribosomes Site of protein SynthesisSite of protein Synthesis

17 The Genetic Code A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Some codons tell the ribosome to stop translating

18 The Genetic Code Use the code by reading from the center to the outside Example: AUG codes for Methionine

19 Name the Amino Acids GGG? UCA? CAU? GCA? AAA?

20 Remember the Complementary Bases On DNA: A-T C-G On RNA: A-U C-G

21 Transfer RNA (tRNA) Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon

22 Transfer RNA amino acid attachment site UAC anticodon

23 Codons and Anticodons The 3 bases of an anticodon are complementary to the 3 bases of a codon Example: Codon ACU Anticodon UGA UGA ACU

24 Transcription and Translation

25 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein

26 Protein Synthesis   The production or synthesis of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA must be processed before it leaves the nucleus of eukaryotic cells

27 DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

28 Transcription The process of copying the sequence of one strand of DNA, the template strand mRNA copies the template strand Requires the enzyme RNA Polymerase

29 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

30 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

31 Transcription During transcription, RNA polymerase binds to DNA and separates the DNA strands RNA Polymerase then uses one strand of DNA as a template to assemble nucleotides into RNA

32 mRNA Transcript mRNA leaves the nucleus through its pores and goes to the ribosomes

33 Translation Translation is the process of decoding the mRNA into a polypeptide chain Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins

34 Transcription Translation

35 End Product –The Protein! The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

36 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

37


Download ppt "PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used."

Similar presentations


Ads by Google