2. The Central Dogma Replication-> Transcription-> Translation Modified from Kim Foglia

3.  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA ( deoxyribonucleic acid)

4.  How does DNA code for cells & bodies?  DNA synthesized ( REPLICATION) ->RNA-> proteins->cells

5.  DNA has the information to build proteins  genes proteins cells bodies DNA gets all the glory, Proteins do all the work

6. cytoplasm nucleus  DNA  DNA is in the nucleus ▪ genes = instructions for making proteins  want to keep it there = protected ▪ “locked in the vault”

8.  2 types of nucleotides  different nitrogen bases  purines ▪ double ring N base ▪ adenine (A) ▪ guanine (G)  pyrimidines ▪ single ring N base ▪ cytosine (C) ▪ thymine (T) ▪ uracil (U) Purine = AG Pure silver!

9.  Nucleotides bond between DNA strands  H bonds phosphodiester bonds  purine :: pyrimidine  A :: T ▪ 2 H bonds  G :: C ▪ 3 H bonds Matching bases? Why is this important?

10.  Need to get DNA gene information from nucleus to cytoplasm  need a copy of DNA  messenger RNA nucleus cytoplasm ribosome mRNA build proteins

11. DNA  deoxyribose sugar  nitrogen bases  G, C, A, T  T : A  C : G  double stranded RNA  ribose sugar  nitrogen bases  G, C, A, U  U : A  C : G  single stranded

12.  Making mRNA from DNA  DNA strand is the template (pattern)  match bases ▪ U : A ▪ G : C  Enzyme  RNA polymerase

13.  Ribonucleic acid  RNA nucleotide ( ribose, phosphate, AUCG)  Phosphodiester bonds  Synthesis ( transcription)  nucleolus

14.  Messenger RNA: carries coded instruction for protein synthesis  Transfer RNA: carries specific amino acids to ribosomes during protein assembly  Ribosomal RNA: part of ribosomes

15.  mRNA leaves nucleus  mRNA goes to ribosomes in cytoplasm  Proteins built from instructions on mRNA aa mRNA UCCCCCCAAUGUGAAAAAGGGGUU

16.  Proteins  chains of amino acids  made by a “protein factory” in cytoplasm  protein factory = ribosome nucleus cytoplasm ribosome build proteins

17.  Proteins  proteins run living organisms  enzymes ▪ control all chemical reactions in living organisms  structure ▪ all living organisms are built out of proteins

18.  Building block = amino acid amino acid – amino acid – amino acid – amino acid – —N——N— H H H | —C— | C—OH || O variable group amino acids  20 different amino acids

19.  Proteins :amino acids chained into a polymer, primary structure held by peptide bonds  Each amino acid is different  some “like” water & dissolve in it  some “fear” water & separate from it amino acid

20.  Primary structure: chain of amino acids held by peptide bonds  Sensitive to temperature, pH and ionic conditions  Protein synthesis occurs on ribosomes

22. mRNADNA transcription nucleus cytoplasm translation trait protein

23. transcription translation protein