Download presentation
Presentation is loading. Please wait.
Published byPiers Arnold Modified over 9 years ago
2
The Central Dogma Replication-> Transcription-> Translation Modified from Kim Foglia
3
Bodies are made up of cells All cells run on a set of instructions spelled out in DNA ( deoxyribonucleic acid)
4
How does DNA code for cells & bodies? DNA synthesized ( REPLICATION) ->RNA-> proteins->cells
5
DNA has the information to build proteins genes proteins cells bodies DNA gets all the glory, Proteins do all the work
6
cytoplasm nucleus DNA DNA is in the nucleus ▪ genes = instructions for making proteins want to keep it there = protected ▪ “locked in the vault”
8
2 types of nucleotides different nitrogen bases purines ▪ double ring N base ▪ adenine (A) ▪ guanine (G) pyrimidines ▪ single ring N base ▪ cytosine (C) ▪ thymine (T) ▪ uracil (U) Purine = AG Pure silver!
9
Nucleotides bond between DNA strands H bonds phosphodiester bonds purine :: pyrimidine A :: T ▪ 2 H bonds G :: C ▪ 3 H bonds Matching bases? Why is this important?
10
Need to get DNA gene information from nucleus to cytoplasm need a copy of DNA messenger RNA nucleus cytoplasm ribosome mRNA build proteins
11
DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded
12
Making mRNA from DNA DNA strand is the template (pattern) match bases ▪ U : A ▪ G : C Enzyme RNA polymerase
13
Ribonucleic acid RNA nucleotide ( ribose, phosphate, AUCG) Phosphodiester bonds Synthesis ( transcription) nucleolus
14
Messenger RNA: carries coded instruction for protein synthesis Transfer RNA: carries specific amino acids to ribosomes during protein assembly Ribosomal RNA: part of ribosomes
15
mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA aa mRNA UCCCCCCAAUGUGAAAAAGGGGUU
16
Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome nucleus cytoplasm ribosome build proteins
17
Proteins proteins run living organisms enzymes ▪ control all chemical reactions in living organisms structure ▪ all living organisms are built out of proteins
18
Building block = amino acid amino acid – amino acid – amino acid – amino acid – —N——N— H H H | —C— | C—OH || O variable group amino acids 20 different amino acids
19
Proteins :amino acids chained into a polymer, primary structure held by peptide bonds Each amino acid is different some “like” water & dissolve in it some “fear” water & separate from it amino acid
20
Primary structure: chain of amino acids held by peptide bonds Sensitive to temperature, pH and ionic conditions Protein synthesis occurs on ribosomes
22
mRNADNA transcription nucleus cytoplasm translation trait protein
23
transcription translation protein
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.