Presentation is loading. Please wait.

Presentation is loading. Please wait.

Simulated Lab Relationships & Biodiversity Botana curus is a valuable plant because it produces Curol, a compound used for treating certain kinds of cancer.

Similar presentations


Presentation on theme: "Simulated Lab Relationships & Biodiversity Botana curus is a valuable plant because it produces Curol, a compound used for treating certain kinds of cancer."— Presentation transcript:

1 Simulated Lab Relationships & Biodiversity Botana curus is a valuable plant because it produces Curol, a compound used for treating certain kinds of cancer. Curol can not be produced in the laboratory. Botana curus grows very slowly and is on the endangered species list, so its ability to provide curol in large quantities is limited.

2 Your Task Species that are closely related to Botana curus are likely to produce the important substance curol. Therefore we need to identify closely related species.

3 Test 1: Compare Plant Structure

4 Test 2: Compare Seeds Compare the structural characteristics of the seed samples. Record your observations in Table 1.

5 Test 3: Compare Stem Structures Compare the structural characteristics of the stem samples. State whether the arrangement of the bundles of conducting tissue is circular or scattered. Record your observations in Table 1. Botana curus Species XSpecies YSpecies Z

6 p.2 Hypothesis a. You must make a hypothesis about which Species (X, Y, or Z) is most closely related to Botana curus based upon ONLY Tests 1-3 b. provide supporting evidence for your hypothesis using data only from Tests 1-3

7 Test 4: Chromatography

8 Test 5: Enzyme M

9 ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Botana curus ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species X ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Y ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATC Species Z Test 6: Gel Electrophoresis

10 # of DNA BasesBotana curusSpecies XSpecies YSpecies Z 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2

11 Test 7: Molecular Evidence for Relationships (p.4) B.c.CAC GTG GAC TGA GGA CTC CTC mRNA___ ___ ___ ___ ____ ___ ___ Amino ___ ___ ___ ___ ____ ___ ___ XCAC GTG GAC AGA GGA CAC CTC mRNA___ ___ ___ ___ ____ ___ ___ Amino ___ ___ ___ ___ ____ ___ ___ GUGCACCUGACUCCUGAG VALHISLEUTHRPROGLU GUGCACCUGUCUCCUGUGGAG VALHISLEUSERPROVALGLU

12 Test 7: Molecular Evidence for Relationships (p.4) YCAC GTG GAC AGA GGA CAC CTC mRNA___ ___ ___ ___ ____ ___ ___ Amino ___ ___ ___ ___ ____ ___ ___ ZCAC GTA GAC TGA GGA CTT CTC mRNA___ ___ ___ ___ ____ ___ ___ Amino ___ ___ ___ ___ ____ ___ ___ GUG CACCUGUCUCCUGUGGAG VALHISLEUSERPROVALGLU GUGCAUCUGACUCCUGAAGAG VALHISLEUTHRPROGLU

13

14 p.5 It is the same as Species Z and different from Species X and Y. 1.Species Z. Botana curus and Species Z both make enzyme M, have the same pigments, and have the exact same amino acid sequence which is evidence that they are closely related. 2.Supported. The molecular evidence supported my hypothesis. OR Refuted. The molecular evidence showed that Botana curus was more closely related to Species Z

15 p.5 3.Molecular. Organisms can look alike on the surface, but have many hidden molecular differences. 4.Having needles, seeds, blue & yellow pigments, and some amino acids (DNA fragments) in common.

16 p.6 5.These common characteristics are most likely due to common ancestry. 6.2. This tree shows Z and Botana curus closer together. 7.Additional evidence may include using indicators to test for other enzymes, comparing fossil records, or comparing DNA fragments using other restriction enzymes.

17 p.7 8. Pollution, deforestation, overhunting, destruction of natural habitats 9. It provides Curol to treat cancer, Maybe the plant has future abilities to provide medicine or food, Extinction is irreversible. 10. Expensive to preserve its habitat, another “species” is closely related to Botana curus so it might make Curol too.

18 SpeciesPlantsSeedsMicro.Paper Chrom. Enzyme M Amino Acid Gel Electro Botana curus NONE Species X Species Y Species Z Circular Scattered Circular Blue Yellow Pink Blue Yellow Pink Blue Yellow Blue Yellow Pink Present Absent Present 2 differences SER not THR Val not GLU 2 differences SER not THR Val not GLU No differences 4 bands 5, 9, 11, 12 3 bands 7, 8, 22 4 bands 3, 5, 12, 17 4 bands 5, 9, 11, 12


Download ppt "Simulated Lab Relationships & Biodiversity Botana curus is a valuable plant because it produces Curol, a compound used for treating certain kinds of cancer."

Similar presentations


Ads by Google