Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein synthesis mb.edu/cellbio/r ibosome.htm.

Similar presentations


Presentation on theme: "Protein synthesis mb.edu/cellbio/r ibosome.htm."— Presentation transcript:

1 Protein synthesis http://cellbio.ut mb.edu/cellbio/r ibosome.htm

2 DNA vs RNA http://faculty.uca.edu/ ~johnc/mbi1440.ht m

3 http://www.alg osobre.com.br/ biologia/dna-e- rna.html

4 Types of RNA Messenger RNA (mRNA): copy of DNA http://www.ncbi.nlm.nih.gov/Class/MLACourse/Modules/MolBioReview/transcription.html

5 Types of RNA Transfer RNA (tRNA):

6 Types of RNA http://www.molecularassembler.com/KSRM/ListFigures.htm http://www.chm.bris.ac.uk/motm/linezolid/linezolid.htm

7 http://www.langara.bc.ca/biology/mario/Biol2315notes/biol2315chap11.html

8

9 Genetic code 20 a.a. But only 4 RNA bases… If 2 nucleotides, only 16 a.a. (4 2 = 16) 3 nucleotides is great 4 3 = 64

10 http://www.cbs.dtu.dk/staff/dave/roanoke/genetics980320f.htm

11 Exercices together Transcribe this DNA into mRNA: ACGGTATTACCGCTA UGCCAUAAUGGCGAU (Answer) Now translate this mRNA into a protein: AUGCAUUGUAUGGGUUAAGCG Met, His, Cys, Met, Gly (stop)

12 Transcription Initiation: 1) RNA polymerase binds to DNA at a promoter region 2) DNA unwounded and template strand exposed

13 Transcription Elongation: 1) mRNA synthesized in 5’ to 3’ using template strand 2) elongation continues and DNA already transcribed rewinds into double- helix

14 Transcription Termination: RNA synthesis stops; mRNA and RNA polymerase are released

15 http://www.dadamo.com/wiki/wiki.pl/Transcription_(DNA_transcriptionhttp://www.dadamo.com/wiki/wiki.pl/Transcription_(DNA_transcription)

16 Check your understanding Biology12 Textbook P. 241 # 1, 3-6, 8-11, 13 and 14

17 Posttranscriptional modifications In eucaryotic cells 5’ cap is added to the start. It’s a 7- methyl guanosine which protects the mRNA from digestion by nucleases and phospohotases. See p. 244 fig. 3 Poly-A tail is added by poly-A polymerase to the 3’end. It’s to protect and helps initiate translation.

18 Posttranscriptional modifications Introns are removed by spliceosomes. http://faculty.uca.edu/~johnc/rnaprot1440.htm

19 Check your understanding Biology12 Textbook P.249 # 1-5, 7-12

20 Translation: Initiation

21 Translation: Elongation About 60 ms/peptide bond!

22 Translation: Termination

23 Animation of the whole protein synthesis: http://207.207.4.198/pub/flash/26/transmenu_s.swf

24 Check your understanding Bio 12 p.254 # 1-4, 6, 7 and 9 Do Activity 5.4.1 p.269-270

25 Point mutation : Substitution of one base

26 Point Mutation : missense and nonsense Silent mutation:

27 Point mutation: insertion and deletion mutation

28 Check your understanding Bio 12 p. 263 # 1, 6-8

29 Control Mechanisms 42 000 genes in humans! Housekeeping genes : always needed in a cell Transcription factors turn genes on when required

30 4 levels of control of gene expression Transcriptional: controls which genes are transcribed or rate of transcription Posttranscriptional: controls posttranscription Translational: controls how often and how fast translation happens Posttranslational: Controls passage through membrane and rate of activation of proteins and time its remains functional.

31 Operon control Operon: cluster of genes under the control of one promoter and one operator in prokaryotic cells Operator: regulatory sequences of DNA to which a repressor protein binds

32 The lac operon http://fig.cox.miami.edu/~cmallery/150/gene/operon.htm

33 The trp operon http://fig.cox.miami.edu/~cmallery/150/gene/feedback.htm

34 Check your understanding Bio12 p. 258 # 1 – 6.


Download ppt "Protein synthesis mb.edu/cellbio/r ibosome.htm."

Similar presentations


Ads by Google