Presentation is loading. Please wait.

Presentation is loading. Please wait.

Biology Chapter Review

Similar presentations


Presentation on theme: "Biology Chapter Review"— Presentation transcript:

1 Biology Chapter 8.5-8.7 Review
Aminno Acids mRNAns Misc Vocabulary Mutation Q $100 Q $100 Q $100 Q $100 Q $100 Q $200 Q $200 Q $200 Q $200 Q $200 Q $300 Q $300 Q $300 Q $300 Q $300 Q $400 Q $400 Q $400 Q $400 Q $400 Q $500 Q $500 Q $500 Q $500 Q $500 Final Jeopardy

2 $100 Question Amino Acids How many amino acids are
Used to make all the proteins The body uses?

3 $100 Answer Amino Acids 20

4 $200 Question Amino Acids How many amino acids are built in this
Line of mRNA augccauaugcgguaacadaguag

5 $200 Answer Amino Acid augccauaugcgguaacacaguag One start AUG
One end UAG 6 amino acids augccauaugcgguaacacaguag

6 $300 Question Amino Acids What are the three nucleitide Bases called that identify an Amino acid?

7 $300 Answer Amino Acid Triplet codon

8 $400 Question Amino Acid What molecule carries the amino
acid coded by mRNA to the ribosome? ?

9 $400 Answer Amino Acid tRNA

10 $500 Question Amino Acid What anticodon pairs with the codon AUG?

11 $500 Answer Amino Acid TAC

12 What happens if the mRNA reading frame is changed??

13 $100 Answer mRNA The amino acid sequence of the
resulting protein changes.

14 $200 Question mRNA What forms the peptide bonds that
link amino acids in a protein??

15 $200 Answer mRNA ribosome

16 $300 Question mRNA How does the lac operon switch off?

17 $300 Answer mRNA A repressor protein binds to the operator.

18 $400 Question mRNA What does NOT happen during mRNA processing
$400 Question mRNA What does NOT happen during mRNA processing? A) introns are cut out B) a cap and tail are added c) exons are removed d) exons are spliced together

19 $400 Answer mRNA C) Exons are removed

20 $500 Question mRNA What determines the order of
Amino acids ina protein?

21 $500 Answer mRNA The order of the mRNA anticodons

22 $100 Question Misc. What is the function of
transcription factors in eukaryotic cells?

23 $100 Answer Misc They help RNA polymerase know where a gene starts

24 $200 Question Misc Genes determine a person’s
Eye color by coding for _________ That affect eye color?

25 $200 Answer Misc proteins

26 $300 Question Misc Why type of bond are created during
Dehydration synthesis?

27 $300 Answer Misc Polypeptide bonds

28 $400 Question Misc Of the 20 amino acids, 12 are found in the cell
And the remaiinng 8 are made from? a)Proteins floating in the cytoplasm b) Water c) Hydrogen d) The food we eat

29 $400 Answer Misc d) From the food we eat

30 $500 Question Misc Proteins are sometimes called?

31 $500 Answer Misc Polypeptide chains

32 $100 Question Vocabulary Define mutagen

33 $100 Answer Vocabulary Agents in the environment that can change DNA

34 $200 Question Vocabulary What is a mutation?

35 $200 Answer Vocabulary Change in the organism’s DNA

36 $300 Question Vocabulary What is frameshift?

37 $300 Answer Vocabulary Insertion or deletion of A nucleotide in DNA

38 $400 Question Vocabulary What is Point Mutation?

39 $400 Answer Vocabulary One nucelotide is substituted For another

40 $500 Question Vocabulary What is chromosomal mutation?

41 $500 Answer Vocabulary Different sized units that have no copy of the gene

42 $100 Question Mutation Cystic Fibrosis is an example of a genetic disease caused by a deletion of a nucleotide . What is the term for this type of mutation?

43 $100 Answer Mutation frameshift

44 What type of mutation has no Effect on phenotype?
$200 Question Mutation What type of mutation has no Effect on phenotype?

45 $200 Answer Mutation Translocation

46 $300 Question Mutation Which is an example of a mutagen? Triglyceride
UV sunlight Thymine

47 $300 Answer Mutation UV Sunlight

48 $400 Question Mutation Mutations that can affect
Offspring occur in what Cell type?

49 $400 Answer Mutation Chromosomal

50 $500 Question Mutation List two causes of mutations

51 b) Environmental Impact on epigenome c) Frame shift d) Point mutation
$500 Answer Mutations a) Inheritated b) Environmental Impact on epigenome c) Frame shift d) Point mutation

52 Final Jeopardy What is the difference between
Transcription and translation?

53 Final Jeopardy Answer Transcription is when the
Nucleotide T is changed to U for mRNA Translation is when the triplet Codon is “read” to create a protein


Download ppt "Biology Chapter Review"

Similar presentations


Ads by Google