1. Why test DNA? Match suspect/victim/evidence Convicted felon databases Missing persons investigations Maternity/paternity – kidnapping Military – remains from war Mass disasters – ID victims DNA Fingerprinting

2. Sources of DNA at a Crime Scene Blood (WBC’s) Semen – sexual offences, (sperm head) Saliva – stamps, envelopes, straw, glass, gum Urine – if blood cells were shed Hair - if follicle, shaft mtDNA Bone Marrow – retains DNA for years Tissue – flesh/organs decompose quickly, not good

3. What are the 2 types of DNA? Nuclear DNA –$–$100-200 per test –2–24-36 hours for results –S–Shows genetic lineage from both parents –O–Only 1 nucleus per cell Mitochondrial DNA (mtDNA) –$1000 per test –1-6 weeks for results –Shows only maternal lineage –Many mitochondria/cell –hours Which type is better for forensic testing?

4. DNA in the Cell chromosome cell nucleus Double stranded DNA molecule Individual nucleotides

5. Each nucleotide contains: Nitrogenous Base Sugar (deoxyribose) Phosphate Group

6. 4 different bases make up the steps of the ladder A Adenine T Thymine G Guanine C Cytosine

7. Base Pairing Rules Sugar- Phosphate backbone G-C A-T

8. Each rung on the ladder is called a 1 base pair (bp) 2 base pair (bp) 3 base pair (bp) How many base-pairs are there in the human genome? ( in 1 nucleus / 46 chromosomes) approximately 3 billion base-pair

9. A C G G T A A G C A T A G C C G T G A G T T T A C C A G

10. The Genetic Code A series of G’s A’s C’s & T’s DNA Fingerprinting: identifies people by their unique genetic code How much of your DNA is identical to everyone else? 99.4%

11. Nuclear DNA is in every nucleated cell of the body. Every body cell has 46 chromosomes. Every sex cell (egg/sperm) has 23 chromosomes.

12. Human Karyotype Genome: all genetic material in a nucleus. Humans: 22 pairs of autosomes 1 pair of sex chromosomes X & Y

13. Organization of the Human Genome Locus – Specific region (address on a chromosome) Gene – region that encodes for a protein or a trait Marker Locus – non-coding region Eye color Dimples Freckles Blood type Non-coding “junk DNA” MOMDAD

14. Organization of the Human Genome Every gene or locus marker can have alternate forms called alleles Blue eyes Dimples No Freckles Type I A Non-coding “junk DNA” For every gene/locus in your DNA you have… 2 alleles. Homozygous (same) Heterozygous (different) MOMDAD Brown eyes No dimples Freckles Type I B How do these alleles differ?

15. DNA (Genes) How much? 5% of genome 30,000 genes Function? Codes for traits & proteins Do we all have the same genes ? Yes, but slightly different alleles Ex: brown, blue, green eyes DNA (Marker Loci) “junk” How much? 95% of genome Function? Somewhat unknown Controls gene expression Do we all have the same marker loci ? Yes, but slightly different alleles Ex: Contains different amounts of tandem repeated segments GACA GACA GACA GACA GACA Polymorphism – an alternate version

16. STR’s Short Tandem Repeats  (smaller segments with fewer repeats) CGAA CGAA CGAA CGAA CGAA CGAA CGAA CGAA CGAA CGAA CGAA VNTR’s Variable Number Tandom Repeats  (larger segments with many repeats) GGACTAATATCTATTCCCTAATATGACTAA AATATTTCGGACTAGATATCTTTCGGACTTA TCTATTCGGGAGCCGCTACCCGTG… …X 1000

17. A locus marker that includes a tandem repeat sequence can have many different alleles in a population. Ex: Allele 1: (6 repeats) GAACT ATTA ATTA ATTA ATTA ATTA ATTA CGTGCAGGCT Allele 2: (5 repeats) GAACT ATTA ATTA ATTA ATTA ATTA CGTGCAGGCT Allele 3: (7 repeats) GAACT ATTA ATTA ATTA ATTA ATTA ATTA ATTA GTGCAGGCT

18. C G C C A T G C A T G T G A G C G C G T A C G C C A C T G C A T G C C G G C G G T A C G T A C A C T C G C G C A T G C G G T G A C G T A C G G C C G C C A T G C A T G T G A G C G C G T A C C T C A C T G C A T G C C G G C G G T A C G T A C A C T C G C G C A T G G A G T G A C G T A C G G C Locus # 1 Locus # 2 A T C A G C A T T G A T T G A T T G A T T G A C C C A T A T G T G A G C G C G T A C C T C A C T G C G T A G T C G T A A C T A A C T A A C T A A C T G G G T A T A C A C T C G C G C A T G G A G T G A C C T G T T G A T C A G C A T T G A T T G A T T G A C C C A T A T G T G A G C G C G T A C C T C A C T G C G C A A C T A G T C G T A A C T A A C T A A C T G G G T A T A C A C T C G C G C A T G G A G T G A C C T

19. This Allelic variation is the basis for forensic DNA testing. Many polymorphic loci in human genome.Many polymorphic loci in human genome. Each locus has many forms (alleles).Each locus has many forms (alleles). How do we process and visualize the DNA for comparison? 2 types of DNA Fingerprinting RFLP (older ) involves STR’s & VNTR’sRFLP (older ) involves STR’s & VNTR’s PCR (newer) involves STR’sPCR (newer) involves STR’s