1. Background and Aims of study Take home notes miR-1 and miR-133a expression were down-regulated in tumor tissues and their expression were positively correlated in normal and tumor tissues. Genome-wide analysis revealed that TAGLN2 and PNP were common target genes of miR-1 and miR-133a. TAGLN2 and PNP expression were inversely correlated with miR-1 and miR-133a expression in HNSCC. Loss-of-function assay indicates that TAGLN2 and PNP may act as oncogenes in HNSCC. TAGLN2 is a member of the calponin family of actin-binding proteins. Overexpression of TAGLN2 was observed in hepatocellular carcinoma, lung adenocarcinoma, pancreatic and bladder cancer. PNP is an enzyme involved in purine metabolism. PNP catalyzes the conversion of adenosine to adenine, inosine to hypoxanthine, and guanosine to guanine, creating ribose phosphate in each case. PNP is considered a therapeutic target in malignant lymphoproliferative diseases. Molecular networks regulated by tumor suppressive microRNA-1 and microRNA-133a in head and neck squamous cell carcinoma Abstract #3152 Nijiro Nohata 1,2, Toyoyuki Hanazawa 1, Takashi Kinoshita 1,2, Naoko Kikkawa 1, Miki Fuse 2, Takeshi Chiyomaru 3, Hirofumi Yoshino 3, Hideki Enokida 3, Masayuki Nakagawa 3, Yoshitaka Okamoto 1 and Naohiko Seki 2 1 Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan 2 Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan 3 Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan AACR 103 rd ANNUAL MEETING, Tuesday April 3, 2012, 8:00 AM – 12:00 PM No.SymbolGene name Log2 ratio miR-1 sitemiR-133a site miR-1miR-133aAverage 1TAGLN2transgelin 2-2.78-1.98-2.3832 2PVRL2 poliovirus receptor-related 2 (herpesvirus entry mediator B) -2.7-1.9-2.3-- 3C4orf34chromosome 4 open reading frame 34-3.01-1.51-2.2621 4KATNAL2katanin p60 subunit A-like 2-2.65-1.69-2.17-- 5CGA glycoprotein hormones, alpha polypeptide -2.38-1.92-2.15-- 6TCTEX1D2Tctex1 domain containing 2-2.12-2.14-2.13-- 7hCG_1817306hypothetical LOC100130691-1.79-2.22-2-- 8KLHL4kelch-like 4 (Drosophila)-1.83-2.08-1.96-- 9FBN1fibrillin 1-1.78-1.98-1.88-- 10PXDNperoxidasin homolog (Drosophila)-1.74-1.99-1.8712 11SLC16A6 solute carrier family 16, member 6 (monocarboxylic acid transporter 7) -2.01-1.7-1.8611 12DOCK8dedicator of cytokinesis 8-2.16-1.55-1.86-- 13C7orf58chromosome 7 open reading frame 58-2.07-1.62-1.84-- 14INSL4insulin-like 4 (placenta)-1.53-2.12-1.83-- 15ZP3 zona pellucida glycoprotein 3 (sperm receptor) -1.76-1.89-1.83-- 16C4orf47chromosome 4 open reading frame 47-1.67-1.97-1.82-- 17CCDC113coiled-coil domain containing 113-1.75-1.83-1.79-- 18STXBP4syntaxin binding protein 4-1.64-1.83-1.7432 19PNPpurine nucleoside phosphorylase-1.66-1.67 11 20LAMP2 lysosomal-associated membrane protein 2 -1.69-1.61-1.65-- 21SGK1 serum/glucocorticoid regulated kinase 1 -1.74-1.56-1.65-1 22BBS1Bardet-Biedl syndrome 1-1.68-1.59-1.64-- 23TRIM4tripartite motif-contaning 4-1.55-1.6-1.58-1 Down-regulated genes by miR-1 and miR-133a in IMC-3 Expression levels of miR-1 and miR-133a in clinical HNSCC samples miR-1 expression (Normalized to RNU48) 0.005 0.010 0.015 0.020 0.025 0.030 0.035 0 p=0.0023 NormalTumor 0.005 0.010 0.015 0.020 0.025 0.030 0.035 0 0.040 p=0.0382 miR-133a expression (Normalized to RNU48) NormalTumor miR-1 expression 0 0.020.04 0 0.025 0.125 miR-133a expression 0.050 0.075 0.100 r=0.571 p<0.001 miR-1 and miR-133a expression levels in tumor tissue were significantly down-regulated in clinical HNSCC samples. Furthermore, miR-1 and miR-133a expression levels were positively correlated in HNSCC samples. 61.0M61.1M61.2M61.3M 61147660 61167971 RPL7P3 LOC100131174 LOC100505735 FLJ32154 LOC100127888 C20orf151GATA5C20orf166-AS1 C20orf166SLCO4A1 10.5Kb miR-1-1miR-133a-2 Exon1234 Chromosome 20q13.33 19.2M19.3M19.4M19.5M 19321545 19450914 SNRPD1ABHD3MIB1 3.2Kb Exon 1 21 Chromosome 18q11.2 miR-320c-1RPL34P32 miR-133a-1miR-1-2 231545678910111213141617181920 Our expression signatures of human cancer including HNSCC revealed that the expression of microRNA-1 (miR-1) and microRNA-133a (miR-133a) were significantly reduced in cancer cells. In human genome, miR-1 and miR-133a located same chromosomal regions (miR-1-2 and miR-133a-1 on 18q11.2, and miR-1-1 and miR-133a-2 on 20q13.33) called cluster. Previously, our group reported that miR-1 and miR-133a function as tumor suppressors in several types of cancers including HNSCC. In this study, we identify the novel molecular networks regulated by miR-1 and miR-133a commonly in HNSCC. Early apoptosis cells (relative to mock) miR-1 and miR-133a Inhibited cell growth and induced apoptosis in IMC-3 (derived from maxillary sinus SCC) NormalTumor 0 1.0 2.0 p=0.0089 PNP expression (Normalized to GUSB) 0 1.0 2.0 3.0 4.0 p=0.0321 NormalTumor TAGLN2 expression (Normalized to GUSB) r=-0.322 p=0.043 miR-1 0 0.02 0 PNP mRNA 0.04 1 2 miR-133a 0 0.050.100.15 0 PNP mRNA 1 2 r=-0.266 p=0.098 miR-1 0 0.02 0 2 4 TAGLN2 mRNA 0.04 r=-0.407 p=0.009 miR-133a 0 0 2 4 TAGLN2 mRNA 0.05 0.10 r=-0.341 p=0.031 0.15 Overexpression of TAGLN2 and PNP in clinical HNSCC samples Inverse correlation between TAGLN2 and miR-1/miR-133a Inverse correlation between PNP and miR-1/miR-133a 0 1 2 3 4 5 6 * * 7 Cell proliferation (% of mock) 0 20 40 60 80 100 120 * * MockControlmiR-1miR-133a * :p<0.05 TAGLN2 and PNP were regulated by miR-1 and miR-133a si-TAGLN2 and si-PNP inhibited cell growth in IMC-3 TAGLN2 β-actin TAGLN2 normalized to β-actin 0 20 40 60 80 100 120 TAGLN2 mRNA expression (relative to mock) 0 20 * 40 60 80 100 120 * TAGLN2 3’UTR length:686 miR-1 target sites miR-133a target sites 0.2k0.4k0.6k PNP mRNA expression (relative to mock) 0 20 * 40 60 80 100 120 * PNP normalized to β-actin 0 20 40 60 80 100 120 PNP 3’UTR length:488 miR-1 target sites miR-133a target sites 0.2k0.4k 5'...GCUCUUUGAGAUAAUACAUUCCG... ||||||| 3' UAUGUAUGAAGAAAUGUAAGGU 5'...AUCUAAAUCACCAGAGACCAAAC... |||||| 3' GUCGACCAACUUCCCCUGGUUU 5'...AUAGCCAUCAAAACUGGACCAAC... ||||||| 3' GUCGACCAACUUCCCCUGGUUU 5'...UCUUCCUUUCCCCUGGGACCAAA... ||||||| 3' GUCGACCAACUUCCCCUGGUUU 5'...UAUAUUUUAGCAGUGACAUUCCC... ||||||| 3' UAUGUAUGAAGAAAUGUAAGGU 5'...CCCAUGCUUACUAAU--ACAUUCCC... |||| ||||||| 3' UAUGUAUGAAGAAAUGUAAGGU 5'...UCUGUGUCCUCCGUUCAUUCCAU... |||||| 3' UAUGUAUGAAGAAAUGUAAGGU MockControlmiR-1miR-133a PNP β-actin * :p<0.05 Cell proliferation (% of mock) 0 20 * 40 60 80 100 120 Cell proliferation (% of mock) 0 20 * 40 60 80 100 120 Mock Control si-TAGLN2 Mock Control si-PNP * :p<0.05