1. Silence of the Genes

2. Genetics The study of inheritance

3. Gregor Mendel (1823-1884)

4. Mendelian Ratios

5. Mutation ATGCGAGCGAGTATGCGATCGAGT Genotype Phenotype

6. Epigenetics Heritable changes in gene expression that do not involve changes in DNA sequence.

7. Epi-mutation ATGCGAACGAGTATGCGATCGAGT Genotype Phenotype DNA Modifications Histone Modifications Proteins

8. Nucleosome DNA histones

9. DNA Methylation histones CH 3

10. Histone Methylation histones CH 3

11. Examples of Epigenetics

12. X-Inactivation inactivation malefemale XYXX unequal expression equal expression XYX X Barr Body

14. Calico Cat XX oO X X o O X X o O orange allele black allele black sector orange sector

15. Other Examples of Epigenetics

16. Imprinting Imprinted genes are expressed differently depending on whether they are inherited through the maternal or paternal parent.

17. Horses and Donkeys male female

18. Gynogenotes Embryos containing two female genomes –do not develop normally –fail due to underdeveloped extraembryonic placental tissue

19. Androgenotes Embryos containing two paternal genomes –result in abnormal (often overgrown) embryo –display overdeveloped extraembryonic placental tissue

20. Maternal vs. Paternal Imprinting Male genome wants to promote growth. Female genome wants to inhibit growth.

21. Resetting Methylation Patterns Primordial Germ Cells male female methylation developmental time

22. Battle for Maintaining DNA Methylation

23. Battle to Maintain Methylation methylation developmental time Fertilization

24. Female Strategy Genes that promote growth Fertilization

25. Male Strategy Antisense Genes that inhibit growth Fertilization

26. Resetting Imprints is Important for Proper Development

27. Dolly First mammal to be cloned from an adult cell. Developed illness common in older sheep (arthritis) Probably due to abnormal imprinting

28. Gene Silencing

29. Heterochromatin Densely staining condensed chromosomal regions; believed to be transcriptionally inert. Euchromatin A chromosomal region that stains normally; thought to contain the normally functioning genes.

30. Heterochromatin Paul Fransz B. McClintock IV

31. Heterochromatin Centromeric regions Telomeric regions

32. Position Effect Variegation W+W+ W+W+ W+W+ W+W+ heterochromatin spreading suppressed enhanced

33. Post-Transcriptional Gene Silencing

34. Anti-Sense

35. Sense Also Works? Guo and Kemphues, (1995)

36. What is Causing Silencing? ?

37. dsRNA Post Transcriptional ? Fire et al. (1998)

38. RNAi ? Fire et al. (1998)

39. RNAi A A A A A A Dicer RISC dsRNA

40. A A A A A A Dicer RISC dsRNA RNAi

41. RNA Silencing cosuppression

42. quelling RNA Silencing

43. Post Transcriptional Gene Silencing (PTGS) RNA Silencing

44. RNA Interference (RNAi)

45. RNA Interference

46. DNA Methylation Mette et al. (2000)

47. RNAi and Transcriptional Silencing

48. Transcriptional Silencing Mette et al. (2000)

49. Micro RNAs Grishok et al. (2001) dicer

50. RNAi Genes in S. pombe?

51. RNAi Genes in pombe? Yes!! Mutation of these genes results in loss of centromeric silencing. Loss of RNAi reveals centromeric transcripts. dsRNA from centromere targets transcriptional silencing.

52. Cen

53. RNAi Small RNAs

54. Cen RNAi Silencing Machinery Small RNAs

55. Cen RNAi Silencing Machinery Small RNAs

56. Cen

57. RNAi Is important for initiation and maintenance of heterochromatin at the centromere. Could be involved in other silencing phenomena

58. Where else may RNAi be functioning to silence genes?

59. X Chromosome Inactivation (RNAi?) Xist Tsix Heard et al (2001)

60. Xist Tsix Heard et al (2001) RNAi Silencing Machinery X Chromosome Inactivation (RNAi?)

61. Xist Tsix Heard et al (2001) RNAi Silencing Machinery X Chromosome Inactivation (RNAi?)

62. Imprinting (RNAi?) Antisense RNAi Silencing Machinery Small RNAs

63. Imprinting (RNAi?) Antisense

64. Imprinting (RNAi?) RNAi Silencing Machinery

65. Heterochromatin Densely staining condensed chromosomal regions; are not necessarily transcriptionally inert. RNAi is important for its initiation and maintenance. Euchromatin Chromosomal regions that do not densely stain; thought to contain functioning genes that may be transcriptionally active.