1. 17.1 Vis_2003 Data Visualization Lecture 17 Information Visualization : Part 3

2. 17.2 Vis_2003 Sequence Visualization n Visualizing sequence of bases, or nucleotides, in DNA is a particularly challenging application n Bases are: GCAT Thanks to Netta Cohen for these three slides

3. 17.3 Vis_2003 Walking through the Genome n Genome sequence is visualized by walking in north (C), south (G), east (T) and west (A) directions, according to the base that is encountered – Walk is not random, but we dont understand all the rules

4. 17.4 Vis_2003 Walking through the Genome in 1D AGCTGCGAGTCGAGTTGGCA… value A,G purines T,C pyrimidines Ui = i Ui

5. 17.5 Vis_2003 Focus and Context n A recurring problem in Information Visualization is lack of screen real estate n Challenge has been addressed in some innovative ways n Want to achieve: – Focus: to see detail of immediate interest – Context: to see the overall picture

6. 17.6 Vis_2003 Bifocal Display n Probably the first suggestion was the bifocal display of Spence and Apperley – Play Spence bifocal_lens movieSpence bifocal_lens movie

7. 17.7 Vis_2003 Bifocal Display n Implemented as an image browser that scales different areas of image in different ways – Chris North, Univ of Maryland

8. 17.8 Vis_2003 What is the Bifocal Display Doing? n Transforming the information space to the display space – Visual transfer functions – cf colour transfer functions in scivis Information space Display Space Normal display Information space Display Space Bifocal display context focus

9. 17.9 Vis_2003 Developing the Idea n Card, Robinson and McKinlay developed the idea into the Perspective Wall Perspective Wall

10. 17.10 Vis_2003 The Perspective Wall 2D layout wrapped around a 3D structure Space utilisation: - detail on centre panel 3x size of equivalent flat wall fitting field of view

11. 17.11 Vis_2003 Perspective Wall n Advantages: – User can adjust ratio of detail to context – Smooth animation helps user perceive object constancy – Relationship between detail and context is consistent: objects bend around the corner

12. 17.12 Vis_2003 Perspective Wall n In terms of transfer function, the situation is closer to the early Spence movie – Perspective gives smoother transition from focus to context Information space Display Space Perspective Wall context focus

13. 17.13 Vis_2003 FishEye Menus n Here is the same idea applied to menus – Ben Bederson, University of Maryland

14. 17.14 Vis_2003 Question n Why is a magnifying glass no good for focus and context?

15. 17.15 Vis_2003 Cone Trees n For large tree structures it is impossible to find sufficient screen space n Cone trees provide a solution n Here is a moviemovie http://research.compaq.com/SRC/3D- animate/conetree.html

16. 17.16 Vis_2003 Focus and Context for Volume Visualization n Marcelo Cohen is studying whether we can apply focus + context ideas to volume visualization

17. 17.17 Vis_2003 Spence Attribute Explorer n Spence has also developed a tool called Attribute Explorer – Compare it with xmdvtool – Look for brushing concept – Here is the moviemovie

18. 17.18 Vis_2003 RSVP n Recent Spence work addresses problem of browsing information spaces – Rapid Serial Visual Processing – To gain a quick view of what is available – Distinction between browsing and searching – Here is the moviemovie

19. 17.19 Vis_2003 Browsing the Web n Spence has also turned his attention to browsing the web – On mobile devices! – Here is the moviemovie

20. 17.20 Vis_2003 Acknowledgements n The movies were taken from Bob Spences Web Site at Imperial College