1. Notes: Pages 6 & 7

2.  1. 5-Carbon Sugar called DEOXYRIBOSE  2. Phosphate Group  3. Nitrogen Base (A, T, C, or G)

3.  A. Adeneine (A)  B. Cytosine (C)  C. Guanine (G)  D. Thymine (T)

4. ADENINECYTOSINE GUANINETHYMINE  In a DNA molecule:  Adenine always pairs with THYMINE  Cytosine always pairs with GUANINE  Thymine always pairs with ADENINE  Guanine always pairs with CYTOSINE

5.  A nucleotide is the BASIC UNIT of structure of a nucleic acid, such as DNA. It consists of a 5-carbon sugar, a phosphate group, and a nitrogen base.

6.  Double Helix  It is often called the WATSON-CRICK Model of DNA, named after two of the scientists that first described its structure.

7.  ATTGCTAACCTAACGATTGG  GGCCTTAAGCCCGGAATTCG  NOTE: In reality, the strands would be lined up NEXT to each other like this:

8.  The process by which a DNA molecule makes an EXACT copy of itself - Base pairs are held together by HYDROGEN BONDS - Before copying begins the DNA molecule UNTWISTS & “UNZIPS” - Bases of free nucleotides in the nucleus form the COMPLIMENTARY strands

9. DNA UNTWISTS DNA “UNZIPS” COMPLEMENTARY STRANDS FORM