2. Everything you wanted to know about DNA but were afraid to ask.

3. DNA A molecule that is present in all living cells and contains the information that determines the traits that a living thing inherits and needs to survive.

4. DNA Gives you your characterisitcs Traits like eye color, height, & hair texture.

5. + DNA’s Two jobs Instruction manual that builds and maintains cells Able to copy itself each time a cell divides

6. DNA DOUBLE HELIX-Twisted ladder or spiral staircase Sides of ladder are made of molecules of sugar called deoxyribose alternating with molecules of phosphate The rungs of the ladder are made of nitrogen bases: AdenineA ThymineT GuanineG Cytosine C

7. A little History Rosalind Franklin She made the first image of an actual DNA molecule using x-ray diffraction Through this breakthrough we learned that DNA has a spiral shape

8. Watson & Crick 1953’s they built the first model of DNA Won the Nobel Prize

9. Erwin Chargaff 1950’s Chargaff found equal amounts between certain base pairs Adenine=Thymine Cytosine=Guanine Called Chargaff’s Rules

10. + Making copies of DNA This occurs in interphase Adenine always pairs w/ Thymine A~~~~~~~~ T Cytosine always pairs w/ Guanine C~~~~~~~~G

11. + How copies are made 1. DNA unwinds and separates (like a zipper) 2. Bases on the open strand are used as a pattern for the new strand 3. Nitrogen bases that are floating in the nucleus pair up with the bases on each half of the unzipped DNA 4. Half of DNA is old & half is new

14. + How DNA works About 2 meters of DNA in every cell of your body It is wound, coiled and bundled to fit inside every cell Order of the bases on one side is a CODE that carries information Gene- is a piece of that code that gives the cell information on the trait it controls

15. + Reading the Code ATTGGCCTTGATCCCCCATAGCGATGTGTACACTC The code is read like a book from one end to another They are split up by 3’s AGC is a code for a protein called “serine”

17. + When things go wrong!

18. + Mutations: the causes DNA damage from environmental agents such as ultraviolet light (sunshine), nuclear radiation or certain chemicals Mistakes that occur when a cell copies its DNA in preparation for cell division. Changes in the number, type, or order of bases on DNA

20. Types of Mutations Deletion- When a base is left out Insertion- When a base is added Substitution - Occurs when the wrong base is used

21. + What can happen? Improved trait No change Harmful trait such as sickle cell disease

22. Clones A new organism with an exact copy of DNA from another organism This is CopyCat: the first cat clone Researchers in Texas have cloned a domestic cat, producing a two- month-old kitten called CopyCat.