2. Population Genetics Evolution depends upon mutation to create new alleles. Evolution occurs as a result of population level changes in allele frequencies. What evolutionary forces alter allele frequencies?

3. How do allele frequencies change in a population from generation to generation?

4. Hardy-Weinberg Principle (1)Allele frequencies in a population will not change, generation after generation. (2)If allele frequencies are given by p and q, the genotype frequencies will be given by p 2, 2pq, and q 2. When none of the evolutionary forces (selection, mutation, drift, migration, non-random mating) are operative:

5. Allele frequencies in the gene pool: A: 12 / 20 = 0.6 a: 8 / 20 = 0.4 Alleles Combine to Yield Genotypic Frequencies

6. Our mice grow-up and generate gametes for next generations gene pool

7. Allele frequency across generations: A General Single Locus, 2 Allele Model Freq A 1 = p Freq A 2 = q

8. Inbreeding Decreases the Frequency of Heterozygotes

9. Inbreeding can reduce mean fitness by “revealing” deleterious recessive alleles. Inbreeding Depression in Humans

10. Inbreeding coefficient (F) = Probability that two alleles are identical by descent AB 0.5 (0.5) 4 = 0.0625 A 0.5 A AA AB 0.5 (0.5) 4 = 0.0625 B 0.5 B BB 0.0625 + 0.0625 = 0.125 What is F for an individual of half sib parents?

11. Box 9B, Figure 1(2) Change of Genotype Frequencies by Inbreeding

12. Heterozygosity in an inbred population = Heterozygosity in a random mating population Prob. not IBD H F = H O (1 - F) Anytime F is greater than 0, the frequency of heterozygotes is lower in an inbred population than in a random mating population. x Heterozygosity and Inbreeding

13. Box 9B, Figure 2. Change of Genotype Frequencies by Inbreeding

14. 9.10 Inbreeding depression in humans

15. 9.11 The golden lion tamarin is a small, highly endangered Brazilian monkey

16. 9.12 Population decline and increase in an inbred population of adders in Sweden

17. Inbreeding increases egg failure in Parus major Can organisms avoid inbreeding depression? Mate Choice Genetic Incompatibility Dispersal

18. Why did fitness decrease after early efforts were implemented to conserve remnant populations? Prairie chicken almost went extinct in the 1950’s.

19. Average number of nDNA alleles per locus Illinois IllinoisOther Pops in pre-bottleneckpresent Midwest 5.12 3.67 5.33-5.88

20. Loss of Habitat Extinction or reduced population sizes Gene Flow - reduced / eliminated Genetic Drift and Non-random Mating Loss of heterozygosity Deleterious alleles increase in frequency Inbreeding Depression -- lowered fitness Extinction or reduced population sizes

21. Measuring Genetic Variation in Natural Populations Historical Method: Examining protein variation via electrophoresis Modern Method: DNA sequencing and typing TTCTTCAGGGGAGGGGGTGGAANATAAAAACAAAAACCCTACAATGTATATTCATCGCCCATAATCGGCTACTTAGACA

22. More than one allele at 30-50% of all loci in a population. Such loci are called polymorphic. LDH-B cline in Fundulus

23. Most populations harbor considerable genetic diversity Heterozygosity 0.100.200.30

24. Heterozygosity has a couple of interpretations: 1)Average percentage of loci that are heterozygous per individual. or 2)Average percentage of individuals that are heterozygous per loci.

25. Polymorphism Polymorphism: when two or more alleles at a locus exist in a population at the same time. Nucleotide diversity:  =  x i x j  ij ij Seq 1 G A G G T G C A A C 0.4 Seq 2 G A G G A C C A A C 0.5 Seq 3 G A G C T G G A A G 0.1 1 2 3 1     2 0.2   3 0.3 0.5 Freq (x)  (0.4)(0.5)(0.2) + (0.4)(0.1)(0.3) + (0.5)(0.1)(0.5) = 0.077       considers # differences and allele frequency

26. In Theory: Under infinite-sites model: Expectation (     4Ne  = frequency of heterozygotes per nucleotide site

27. Nucleotide diversity is low in humans Average nucleotide diversity per site across loci

28. ATCCGGCTTTCGA K = 3 for-->ATCCGAATTTCGA ATTCGCCTTTCGA K= Number of segregating (variable) sites in a sample of alleles. Polymorphism is also estimated by: Expectation (K    In Theory: Where a = 1 + 1/2 + 1/3 +……..1/n-1

29. (75 x 2) + (24) / (102 x 2) = 85.3 75/102 + 1/2 (24/102) = 85.3 Counting alleles or Genotypic frequencies

30. Sequencing Studies Have Revealed Enormous Genetic Diversity CFTR Locus

31. Measuring Genetic Variation in Natural Populations Other Methods: EST approach AFLPs Microsatellites

32. AAAAAAAA TTTTTTTTT Exon 3` UTR An EST is a tiny portion of an entire gene TTTTTTTTT Contextual Region Polymorphic Region

34. Figure 4. Venn diagram of BLAST comparisons among amphibian EST projects. Values provided are numbers of reciprocal best BLAST hits (E<10 -20 ) among quality masked A. mexicanum and A. t. tigrinum assemblies and a publicly available X. tropicalis EST assembly. A. mex. 7909 A. t. tig. 6912 2296 523 X. trop. 34,296 465 353

35. EST Projects: A quick way to obtain complete mtDNA genome sequence. Mt DNA : 22 tRNAs, 2 rRNAs, 13 mRNA Homoplasmic, maternal transmission, evolves quickly Approximately 1-2% sequence divergence / million years

36. # SNPs per EST A. mexicanum A. t. tigrinum ~ 5% mtDNA sequence divergence

37. Microsatellites See Figure 3.19 for pict showing gel separation of microsat alleles Co-dominant marker type Found in essentially all genomes Evolve at a very high rate (10 -3 - 10 -4 per locus per gamete per generation)

38. A A T C C T A G T A T A T A T T A G G A T C A T A T A T G T G C T T A A 5’3’ T T A G G A T C A T A T A T G T G C T T A A A A T C T A T A T A C A C G A A T T 5’3’ TATA A G TCTC Replication inserting TA A A T C T A T A T T A G G A T C A T A T A T G T G C T T A A 5’3’ TATA A G TCTC Insertion during DNA replication

39. A A T C C T A G T A T A T A T T A G G A T C A T A T A T G T G C T T A A 5’3’ A A T C C T A G T A T A T A T T A G A T A T G T G C T T A A 5’3’ GAGA TATA T C Mispairing of DNA during replication A A T C C T A G T A T A C A C G A A T T T T A G A T A T G T G C T T A A 5’ 3’ GAGA TATA T C T A is excised Replication of DNA Deletion during DNA replication

40. A A T C C T A G T A T A T A C A C G A A T T T T A G G A T C A T A T A T G T G C T T A A 5’3’ A G A A T C T A T A T A C A C G A A T T T T A G G A T C A T A T A T G T G C T T A A 5’3’ TATA TCTC Excision and repair inserts TA G T A A T C T A T A C A C G A A T T T T A G G A T C A T A T T T A A 5’ 3’ TATA A G TCTC ATAT CGCG Slipped-strand mispairing Insertion in non-replicating DNA

41. AFLP (Amplified Fragment Length Polymorphisms) RD of DNA Ligation of adaptors creates PCR primer recognition sequence Subsequent selective PCR allows sampling of for restriction length polymorphisms E MM Allele 1 E M Allele 2

42. AFLP Gel

43. Representative Molecular Approaches Genetic/Phylogenetic Resolution vs Appropriateness Clonality Parentage Populations Species Restriction Fragment Analysis * * ***** DNA sequencing/typing overkill overkill ****** mt DNA na na ** *** AFLPs * * * * Microsatellites *** *** ** na From Avise’s book