Presentation is loading. Please wait.

Presentation is loading. Please wait.

AP Biology Lecture #33 Translation.

Similar presentations


Presentation on theme: "AP Biology Lecture #33 Translation."— Presentation transcript:

1 AP Biology Lecture #33 Translation

2 From gene to protein DNA mRNA protein trait nucleus cytoplasm
aa nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

3 from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language

4 How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 20

5 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

6 Cracking the code WHYDIDTHEREDBATEATTHEFATRAT
1960 | 1968 Cracking the code Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine

7 Marshall Nirenberg 1960 | 1968 Har Khorana

8 The code Code for ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

9 How are the codons matched to amino acids?
3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

10 From gene to protein DNA mRNA protein trait nucleus cytoplasm
aa nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

11 Transfer RNA structure
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

12 Loading tRNA Aminoacyl tRNA synthetase
enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG codon of mRNA

13 Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

14 Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site)
holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met A C 5' U A U G 3' E P A

15 Building a polypeptide
1 2 3 Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

16 Protein targeting Signal peptide address label Destinations: secretion
nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Signal peptide address label start of a secretory pathway

17 Can you tell the story? RNA polymerase DNA amino acids exon intron
tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail large ribosomal subunit 3' polypeptide 5' tRNA small ribosomal subunit E P A ribosome

18

19

20

21

22

23


Download ppt "AP Biology Lecture #33 Translation."

Similar presentations


Ads by Google