1. Molecular basis of Chronic Myelo-Monocytic Leukemia Madrid, April 5 th, 2013

2. Overview Disease definition & causes of death Genetic mutations Frequence Clonal architecture GM-CSF hypersensitivity Abnormal gene expression w/o mutation Prognostic significance of gene mutation / deregulation Impact on current disease management

3. CMML a disease defined by one positive criteria Clonal (oligoclonal?) disease of the HSC with monocytosis - Monocytosis (> 1 G/L) that persists for at least 3 months - NOT a CML Lack of Philadelphia chromosome Ph1 or BCR-ABL - NOT a MLN-Eo Lack of PDGFR/FGFR rearrangement and eosinophilia - NOT an AML Blood and bone marrow blast cells < 20% - In most cases : cell dysplasia, at least one cell line Tefferi A, Vardiman JW. Leukemia. 2008;22:14-22.

4. Persistant monocytosis > 1 G/L Why do these patients die?

5. The best recognized prognostic factor is blast cell count Diagnostic feature Peripheral blood blasts Bone marrow blasts CMML1 < 5% < 10% CMML2 5-19% 10-19% Patients die in < 3 years from Progression to AML (< 25%) Consequences of cytopenias

6.  -defensins HNP1-3 CD14-/CD24+ Immature granulocytes CD14+/CD24- Monocytes Lymphocytes Macrophages CSF1 « Monocytes » include a fraction of dysplastic granulocytes endowed with immunosuppressive properties Droin N et al, Blood. 2010;115:78-88

7. Persistant monocytosis > 1 G/L Why do these patients die? Progression to acute leukemia Consequences of cytopenias Immune system deregulation

8. Molecular abnormalities in CMML cells 1 - Non specific cytogenetic abnormalities* 30-40 % 2 - Gene mutations (5-20 / patient)100 % > 30 recurrently mutated genes 3 - Deregulated expression of genes (down, up)100 % * Such E et al, Haematologica. 2011;96:375-83

9. Genetested (n)mutated (n,%) ASXL1312125 (40%) TET2262151 (58%) SRSF2220101 (46%) RUNX126339 (15%) NRAS26329 (11%) CBL26427 (10%) JAK226321 (8%) KRAS26320 (8%) ZRSF218915 (8%) IDH222913 (6%) SF3B122013 (6%) U2AF3522011 (5%) EZH21738 (5%) FLT32648 (3%) DNMT3A2275 (2%) NPM12603 (1%) IDH12291 (<1%) KIT2281 (<1%) TP532022 (1%) Gene mutations The 3 most frequently mutated genes are TET2 SRSF2 ASXL1 Studied in sorted peripheral blood monocytes Itzykson R et al, J Clin Oncol, 2013, in press Damm F et al, Leukemia, 2013, in press

10. TET2 SRSF2 ASXL1 TET2 mutations associate with SRSF2 mutations 2 CMML groups ? TET2 +/- SRSF2 ASXL1 Itzykson R et al, J Clin Oncol, 2013, in press

11. Gene mutations in CMML Three frequently mutated genes TET2 +/- SRSF2 & ASXL1

12. 0 1 2 3 4 5 6 8 43 47 51 19 4 1 The number of mutations in a survey of 19 candidate genes affects the prognostic ~70% cases

13. Single cell analysis of the mutations in 4 bone marrow cell compartments 19 genes sequenced on sorted CD14+ blood cells and HSC/MPP/CMP/GMP sorted Seeded at 1 cell per well Cultured for 12 days with cytokines Colonies picked up In each colony, mutation specific PCR

14. Early clonal dominance specifies CMML among myeloid neoplasms 0 20 40 60 80 100 # 537# 500# 428# 497# 654# 536# 531# 518# 507# 501# 462 # 524# 743# 514# 731# 662 # 516# 550# 632# 495# 498# 586# 644# 759# 736# 658 63 61 9 102 22 46 16 160 20 67 46 48 67 37 119 95 51 49 56 72 10 49 32 93 70 28 HSC : CD34+/CD38-/CD90+ Black 0 mutation Yellow 1 mutation Orange2 mutations Red3 mutations

15. Clonal architecture in CMML (1/3) TET2SRSF2KRAS Early clonal dominance in HSC Linear acquisition of mutations, starting with epigenetic and splice genes Growth advantage to the more mutated cells with differentiation Itzykson R et al, Blood. 2013 Jan 14.

16. Clonal architecture in CMML (2/3) Growth advantage to the more mutated cells with differentiation

17. KRAS homozygous KRAS wildtype Exome sequencing in blood leukemic cells (16 variants :14 SNP, 2 indels) Single cell analysis in CD34+ cells Linear accumulation of mutations with some branching through HR TET2 heterozygous U2AF35 BFSP2 TRAPPC6B CTTNBP2 MYLK TET2 homozygous U2AF35 BFSP2 TRAPPC6B CTTNBP2 MYLK KRASheterozygous ASAP1 ADCY10 ATP2C2 CEP63 HECW2 SIPA1L2 SMOC2 TET2 homozygous U2AF35 BFSP2 TRAPPC6B CTTNBP2 MYLK KRAS heterozygous ASAP1 ADCY10 ATP2C2 CEP63 HECW2 SIPA1L2 SMOC2 SH2B3 CTCF Clone 1 N =10 Clone 2 N = 1 Clone 3 N = 73 Clone 4 N = 7 Clone 5 N = 9 TET2 homozygous U2AF35 BFSP2 TRAPPC6B CTTNBP2 MYLK KRAS homozygous ASAP1 ADCY10 ATP2C2 CEP63 HECW2 SIPA1L2 SMOC2 SH2B3 CTCF Clonal architecture in CMML (3/3)

18. Clonal architecture in CMML Early clonal dominance Mostly linear acquisition of mutations Some branching due to mitotic recombinations Growth advantage to the most mutated cells Limited effect of current therapeutic approaches

19. 13 TET2 mut chronic myeloid malignancies (8 JAK2 V617F MPN, 5 MDS) CD34 + /CD38 - P=0.006CD34 + /CD38 + P=0.08 Early dominance of TET2 mutations may participate to the differentiation bias

20. Sh:SCR Sh:TET2 Sh:SCR Sh:TET2 CD34 + /CD38 - CD34 + /CD38 + ns * 4.0 3.0 2.0 1.0 0.0 (CD33+) GPA- / GPA+ Cord Blood CD34 +

21. Proposed model to distinguish CMML from other chronic myeloid neoplasms CD34 + /CD38 - CD34 + /CD38 + TET2 gene mutation Other chronic myeloid neoplasms CMML CD34 - Clonal Expansion Myeloid Differentiation Additional mutations? Different HSC of origin? Stochastic?

22. The mutated gene SF3B1 and ring sideroblasts The altered pathway Signaling genes and proliferative forms of CMML The allele burden JAK2 in ET versus PV The early / late amplification TET2 and monocytosis Four parameters that affect the phenotype in chronic myeloid diseases

23. JMML is a RAS disease Hypersensitivity of progenenitors to GM-CSF Germline 10% Neurofibromatosis (NF1) Noonan syndrome (PTPN11, CBL) Somatic 90% Inactivating homozygous mutations in PTPN11, NF1, CBL Activating mutations in NRAS, or KRAS Usually only one mutation / patient by WGS Loh ML. Br J Haematol. 2011;152:677-87.

24. In CMML, hypersensitivity of GM-CSF is inconstant Serum-free + SCF GM-CSF 10 ng/mL Mutation in a signaling gene NRAS, JAK2, CBL 6/7 cases 3/13 cases Itzykson R et al, unpublished

25. GM-CSF hypersensitivity Heterogeneous (contrary to JMML) Mostly linked to mutations in signaling genes

26. Peripheral blood 0 1 2 3 4 Ctrl //// 1-1314-2627-39≥40 Monocytes (k/mm 3 ) Weeks n=11n=23 n=12n=23 n=12n=20n=9n=9* ** Gr1-FITC Mac1-Alexa647Ctrl ////44%1%3%51% Ctrl //// 1 cm Spleen In the mouse, deletion of tif1  in myeloid cells (Transcription Intermediary Factor 1  ) induces a CMML phenotype Aucagne R et al, J Clin Invest. 2011;121:2361-70

27. TIF1  gene promoter is methylated in 35-40% of CMML 35% of patients -139 GGGAGGAYGT TYGTGYGTA YGTGYGYGTGT YGTAAT YGTTT TT TTTTAAA YGYGYGA YGYG -139 GGGAGGACGTCCGTGCGTACGTGCGCGTGCCGCAACCGCCCTCCTTCAAACGCGCGACGCG unconverted non methylated methylated Control TIF1  low TIF1  normal expression (Subset # 1) (Part of subset # 2) Aucagne R et al, J Clin Invest. 2011;121:2361-70

28. Cycles 0 20 40 60 80 100 120 5 7 15 Tif1  mRNA level 0 Ctrl Dec. 170 TIF1  HSC70 72 Before treatment After 5 cycles -92 AAATGTGTGATGTGAGGGTGGGGGCGCCGCGTGCGTGTGTG C C C C -92 AAATGTGTGATGTGAGGGTGGGGGTGTTGTGTGTGTGTGTG Before decitabine After decitabine TIF1  expression increase in CD14 + cells as a biomarker of HMA efficacy Aucagne R et al, J Clin Invest. 2011;121:2361-70

29. Low TIF1  Normal TIF1  1.0 0.8 0.6 0.4 0.2 0.0 0 6 12 18 24 30 Months Cumulative probablility of survival TIF1  expression level does not predict decitabine efficacy 0 50 100 150 200 250 300 mRNA expression (relative) Control Subset # 1 Subset # 2 Braun et al, Blood. 2011;118:3824-31.

30. P = 0.06 Cumulative probablility of survival 1.0 0.8 0.6 0.4 0.2 0.0 Low High CJUN 1.0 0.8 0.6 0.4 0.2 0.0 CMYB Low High P = 0.01 0 6 12 18 24 30 Months Months Elevated CJUN and CMYB levels are negative prognostic factors Braun et al, Blood. 2011;118:3824-31.

31. CMML: deregulated gene expression Down P15/INK4b – 50% TIF1  – 40% miR-150 Up cJUN cMYB Prognostic impactNo prognostic impact

32. wildtype mutated 1203624486012036244860 Overall Survival (%) 100 80 60 40 20 0 187 125 134 68 84 29 50 10 19 6 5 1 187 125 134 68 84 29 50 10 19 6 5 1 187 125 126 56 77 23 47 9 18 6 5 1 187 125 126 56 77 23 47 9 18 6 5 1 1203624486012036244860 AML-free Survival (%) 100 80 60 40 20 0 wildtype mutated Univariate analysis ASXL1 : P < 0.0001 also SRSF2 : P = 0.03 CBL : P = 0.003 IDH2 :P = 0.03 ASXL1 mutations have a negative prognostic impact Itzykson R et al, J Clin Oncol, 2013, in press

33. A simplified prognostic score that includes ASXL1 mutations Training (GFM) : 312 Validation (MLL) :165 Low Int High Low Int High Hyperleucocytosis (>15) Age (>65) Anemia Thrombocytopenia (<100) ASXL1 mutation Low < 4 Intermediate 4-8 High >8 Absence 0 Presence 3 2 Itzykson R et al, J Clin Oncol, 2013, in press

34. To refine the diagnosis BCR-ABL PDGFR/FGFR KIT To capture prognostic informations ASXL1 Molecular characterization of CMML in clinical practice

35. Which molecular analyses ? Monocytes > 1 G/L Yes (MLN-Eo) Imatinib Eliminate BCR-ABL Others ASXL1, Complex Karyotype Eosinophilia PDGFR / FGFR Mast cells KIT Yes (SM) TKI? Yes HSCT?

36. Which therapeutic proposal? Leucocyte count < 13 G/L > 13 G/L 0 ou 1 > 1 Poor prognostic factors HSCT HMA Hydroxyurea Best supportive care IPSS Yes No HSCT HMA

37. 1 - CMML : a disease of the HSC in which gene mutations accumulate, mostly linearly, and the most mutated cells accumulate with differentiation. 2 - High number of genetic abnormalities with mutations inTET2, SRSF2 and ASXL1 being the most prominent. 3 - Mutations in signaling genes and early clonal dominance of TET2 mutations favor GM amplification. 4 – Treatment of poor prognostic CMML: ABMT (rarely feasible) and hypomethylating agents 5 – Molecular informations may better guide the therapeutic choice in coming years, with ASXL1 mutations affecting outcome

38. Gustave Roussy, Villejuif, France Raphael Itzykson Nathalie Droin Hana Raslova Margot Morabito François Delhommeau Philippe Rameau Cédric Oréar Guillaume Meurice William Vainchenker Olivier Bernard Marseille, France Daniel Birnbaum Véronique Gelsi-Boyer Groupe Francophone des Myélodysplasies P. Fenaux And all GFM clinical teams Lille, France Aline Renneville Claude Preudhomme Cochin, France Olivier Kosmider Michaela Fontenay Southampton, GB Claire Hidalgo-Curtis Nicholas Cross Dresden, Munich, Germany Uwe Platzbecker Thorsten Haferlach Suzanne Schnittger red blood cell Haematopoietic stem cell Lympho-myeloid progenitor cell lymphoid progenitor cell MEP BFU-E CFU-E CFU-MK CFU-GM CFU-MCFU-G plateletgranulocyteT cellB cellNK erythro MGK CFU-BCFU-T monocyte