Download presentation
Presentation is loading. Please wait.
Published byDaisy Melissa Dennis Modified over 9 years ago
1
Homework comments Read rubrics thoroughly! Any problems with groups, report to me immediately Quantum mine bonus scores added to pattern master scores 1
2
Exit Condition - 20% of quiz 1.) Pair up (two in a group) 2.) Write your names and SECTION at the top of the paper 3.) EXPLAIN the process of TRANSLATION Include the following in your answer: tRNA mRNA ribosome UAG codon RNA Polymerase aminoacyl tRNA synthetase termination factor diffusion 1.) Pair up (two in a group) 2.) Write your names and SECTION at the top of the paper 3.) EXPLAIN the process of TRANSLATION Include the following in your answer: tRNA mRNA ribosome UAG codon RNA Polymerase aminoacyl tRNA synthetase termination factor diffusion
3
3 Translation: Changing languages How?Why? Transcription: Writing again
4
4 Today we’ll go from here... To here Text We can do anything
5
5 Off to see the wizard... DNA replication both strands => new DNA => new cell Transcription 1 strand => new RNA => new protein Sending ‘messages’ out from DNA
6
6 Transcription: seeing it http://www.hhmi.org/biointeractive/media/DNAi_transcription_vo1-lg.mov
7
7 Amino acids From 4 letters of storage/information to 20 letters of action!! From 4 letters of storage/information to 20 letters of action!!
8
8 20 toys EVERY one has a blue part. Chem name? EVERY one has a red part. Chem name? Thus these are all...? How many are there?
9
9 aaDancer Why do nucleotides look like nucleotides, while amino acids look like amino acids? Remember the handshakes What are amino acids ‘for’?
10
10 Different tools; different jobs You & partner have an amino acid; which is it? (StructViewer or homepage => left column ‘big twenty’ amino acids) In what ways are all bases identical? Different? In what ways are all amino acids identical? Different? Which set is more diverse in terms of ‘feel’? Which more diverse in terms of shape? Which would allow you to build more diverse shapes & surfaces?
11
11 Mutation--not always bad While the comparison is often made, proteins are not sentences An amino acid is a collection of properties; changing from one to another changes a region of the protein by (little/some/a lot/completely) It’s an exaggeration, but think of amino acids more like different vacuum cleaner nozzles
12
12 How does a codon ‘mean’ an amino acid?
13
13 Walking the walk How bio machines translate the language of nucleotides into an amino acid string
14
Translation Key Players – define with a partner RNA polymerase (important in transcription but necessary for the prep of translation) mRNA tRNA Aminoacyl tRNA synthetase Ribosome Termination factor 14
15
15 DNA template strand 5’ CTTAAATCCGAATGCCCATG 3’ How should the complimentary strand go?
16
16 DNA template strand (alternate version) 5 ’ CTTAAATCCGAATGCCCATG 3 ’ 5’ end is pointy/spiky 3’ end is soft/furry
17
17 Roles--for single mRNA 4 tRNA (8 pp) 4 pairs to be synthetases (8 pp) 1 small ribosomal subunit x 1 person 1 large ribosomal subunit x 1 person 2 to be (RNA polymerase & the RNA it makes ) 1 termination factor (1 person) 5’ end is pointy/spiky 3’ end is soft/furry
18
18 Learning your ‘lines’ Handout: Each group find questions related to their role; answer them Lab manual, textbook, internet OK as sources RNA polymerase answer mRNA questions Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts 5’ end is pointy/spiky 3’ end is soft/furry
19
19 Special powers Recall that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!
20
20 Choreographing translation A play of many parts, many players, no brains
21
21 Going with the flow mRNA at the central bench ribosome assembles around it synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) tRNAs will ‘diffuse’ by following a path through the room When any event first happens*, action stops, molecules involved will announce, explain Go until a protein happens *This includes non-events (rejections, etc.)
22
22 Walk-through with 1 tRNA Everybody watches visits to synthetase, ribosome In the real world, everything is happening all the time; all is happenstance
23
23 Who knows the code? What happens if a tRNA carries the wrong amino acid? What happens if the mRNA contains a copy error relative to DNA? What happens if a tRNA has a mutated anticodon
24
24 Review movie http://www.youtube.com/watch?v=-zb6r1MMTkc
25
25 Meet your semester-long interest
26
26 Semester Project ❖ Desktop Lab 4 ❖ Perform the experiment with a group ❖ For the next week or so, come up with hypotheses for what is going on, think about ways to test this phenomenon
27
27 Homework StructViewer*--amino acid look & feel** Begin thinking about your project Assessor: mutation & translation *As will always be the case in this course, no tricks; focus on the primary idea(s) **‘SurfaceViewer’ link from Software page may help...Ch. 3 reading about the immune system is just for fun StructViewer*--amino acid look & feel** Begin thinking about your project Assessor: mutation & translation *As will always be the case in this course, no tricks; focus on the primary idea(s) **‘SurfaceViewer’ link from Software page may help...Ch. 3 reading about the immune system is just for fun
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.