1. Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA

2. Constructing Complex Molecular Objects (Development/Morphogenesis) Information specifies a process that creates organization

3. Creating Order Blueprints, Template ------------- Arbitrary structure. Larger object requires larger template. Periodic crystals ------------- Few components, large homogeneous object. Algorithmic growth ------------- Few components, large intelligently-organized object.

4. Nadrian Seeman & DNA nanotechnology

5. Chemical structure of DNA G A A G T C C T

6. DNA single-strandeddouble-stranded AGTCTTCGAATGCTAATTGCGCT AGCGCAATTAGCATTCGAAGACT

7. Designing DNA molecular complexes Nadrian Seeman, 1980’s  GATTACA CTAATGT TAGGCAG ATCCGTC ACTGGTG TGACCAC GATTACA CTAATGT ATCCGTC TGACCACACTGGTG TAGGCAG

8. Chen and Seeman, Nature 350, 631 (1991).

9. Periodic 2-tile crystal (DAO-E lattice) TCACT AGTGA CATAC GTATG TCTTG AGAACATCTC TAGAG Winfree, Liu, Wenzler, Seeman, Nature 394: 539-544 (1998) 1 2 4 3 3 4 2 1

10. Self-Assembly of DNA

11. High resolution AFM imaging Hole = lattice defect Conformation of helix and sticky ends? Rizal Hariadi, Winfree group crystal growth movie

12. Some variations Mao, Sun, Seeman, JACS 1999 Winfree, Liu, Wenzler, Seeman, Nature, 1998 LaBean et al, JACS, 2000

13. More variations 1D ribbons 1D tubes (Schulman, Winfree, 06) Zigzag ribbon 2D periodic lattices Nano-track 3-helix bundle TX-tube 6-helix bundle 4x4 tube DX tube DX lattice TX lattice 4x4 lattices triangle lattice hexagonal lattice 3 point-star lattices symmetry lattice single-strand DX-like tubes … Rhombus ribbon … (Mao, Sun & Seeman, 1999) Rhombus lattice (Mao, Sun & Seeman 99) (Winfree, Liu, Wenzler & Seeman 98) (LaBean, Yan, Kopatsch, Liu, Winfree, Reif, & Seeman 00) (Liu, Park, Reif & LaBean 04) (Liu, Wang, Deng, Walulu & Mao 04) (He, Tian, Chen, Deng, Ribbe & Mao 05) (He, Chen, Liu, Ribbe & Mao 05) (He, Chen, Liu, Ribbe & Mao 05) (Park, Yin, Liu, Reif LaBean & Yan 05) (Park, Barish, Li, Reif, Finkelstein,Yan & LaBean 05) (Rothemund, Ekani-Nkodo, Papadakis, Kumar, Fygenson & Winfree 04) … (Mathieu, Liao, Kopatsch, Wang, Mao & Seeman 05) Chiral DX tube (Mitchell, Harris, Malo, Bath &Turberfield 04) HJ lattice (Malo, Mitchell, Venien- Bryan, Harris,Wille, Sherratt & Turberfield 05) (Reishus, Shaw, Brun, Chelyapov & Adleman 05) DDX lattice (Chelyapov, Brun, Gopalkrishnan, Reishus, Shaw & Adleman 04) (Yan, Park, Finkelstein, Reif & LaBean 03) (Yan, Park, Finkelstein, Reif & LaBean 03) TX ribbon (Li, Park, Reif, LaBean, Yan 03) (Rothemund 05) SAO lattice

14. DNA computing Adleman, Science (1994) Len Adleman: DNA self-assembly is programmable

15. The Sierpinski Triangle (aka Pascal’s Triangle mod 2) 00 0000010000000 00 000011000000 00 000010100000 00 000111100000 00 000100010000 00 001100110000 00 001010101000 00 000011000000 each new number is the sum of the two below it Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004

16. The Sierpinski Triangle (aka Pascal’s Triangle mod 2) Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004

17. The Sierpinski Triangle (aka Pascal’s Triangle mod 2) Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004

18. DAO-E Sierpinski Tile Set decorrelation moviepowers of two movie

19. Making the boundary (the input string) 750 nm } 25 nm

20. DAO-E Sierpinski experiments Algorithmic crystals 1.6 um scan decorrelation movie scaffold strand algorithmic growth errors during assembly

21. DAO-E Sierpinski triangle experiments Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2: e424 (2004) 340nm

23. Scaffolded DNA origami

24. Folding long single-stranded DNA The sequence of DNA provides unique addresses for each location. “Staple strands” bind locations together according to the design.

25. Folding long single-stranded DNA The sequence of DNA provides unique addresses for each location. “Staple strands” bind locations together according to the design.

26. Folding long single-stranded DNA The sequence of DNA provides unique addresses for each location. “Staple strands” bind locations together according to the design.

27. Scaffolded DNA origami

30. Creating Order Blueprints, Template ------------- Arbitrary structure. Larger object requires larger template. Periodic crystals ------------- Few components, large homogeneous object. Algorithmic growth ------------- Few components, large intelligently-organized object.