1. killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

2. DT40: A genetically tractable eukaryotic cell line DT40 Genetically tractable Good model for genome stability in mammals Complementation by human genes Good database versus humans

3. Genetically tractable DT40 All these require manipulation of the genome Phenotypic analysis Knocking out or mutating genes and looking at cellular function Mapping genetic pathways Combining mutations- epistasis Structure/function analysis/ cell biology Complementation, proteomics Genetic regulation Reporter assays

4. Integrate DNA Target DNA Alter DNA Remove DNA * *

5. Random Integration- non homologous end joining Targeted Integration- Homologous/Homeologous recombination Site specific recombination Genetic Recombination is our tool

6. Non Homologous End Joining-Random integration Advantages Simple Relatively high frequency Potential uncharacterised genetic effect Multiple integration Shut down of expression Disadvantages Ku, DNA-PKcs, LigIV,

7. Homologous recombination- site specific integration, gene disruption, mutation DNA End Resection Mre11/RAD50/NBS1, CtIP, Exo1 Strand Invasion RAD51 Resolution Slx1/4, GEN1 Branch Migration RAD51BCD Holliday Junctions

8. Homologous recombination

9. Homologous Recombination Advantage s Acurate/error free Introduction of multiple changes Disdvantages Easy to introduce errors Aberrant recombination Neighbouring sequences Epistasis difficult for HR genes

10. Site specific recombination- cre/lox ATAACTTCGTATAGCATACATTATACGAAGTTAT LOXP

11. Site specific recombination- re-using antibiotic resistance Cre recombinase drug r synapsis excision

12. Site specific recombination Courtesy of the National Library of Medicine (NLM)

13. Understanding recombination is the key to manipulating the DT40 genome

14. 3 copies of chromosome 2 Genomes are ‘plastic’- Don’t culture for too long Words of warning