2. Unit 4: Molecular Genetics Left sidePg #Right SidePg # Unit Page58Table of contents59 Double Bubble60C.N. – DNA & RNA Structure 61 DNA & RNA Coloring62

3. DNA & RNA Unit 4: DNA & RNA Chapter 12-1

4. Learning Goals 1. What is the primary job of DNA? Why are genes important? 2. Describe the structure of DNA. (Include the 3 parts of a nucleotide) 3. Explain the base pairing rules. 4. Describe the parts of a DNA double helix 5. Compare & Contrast DNA & RNA (Give at least 2 similarities & 2 differences.

5. Nucleic Acids DNA and RNA are nucleic acids (polymer) made up of nucleotides (monomer). DNA’s primary purpose is to code for proteins. –Proteins express our genes!

6. DNA: deoxyribonucleic acid Genes are made up of DNA –1. Genes carry information from one generation to the next. –2. Genes determine inherited traits. –3. Genes are easily copied.

7. Structure of DNA Made up of nucleotides (3 parts of a nucleotide): –1) Deoxyribose: a sugar –2) Phosphate group: bonds one nucleotide to the next sugar –3) Nitrogenous base: there are 4 kinds of bases in DNA

9. There are four kinds of bases in DNA: Purines = adenine(A) & guanine(G) Pyrimidines = cytosine(C) & thymine (T)

10. Nucleotides

11. Base Pairing Rules –Hydrogen bonds can only form between certain base pairs: 1)adenine only bonds to thymine (Aunt = Tia) 2)guanine only bonds to cytosine (Cat = Gato)

14. Practice pairing the bases to complete the DNA ATCGGCTCAATCGATTACCA TAGC

15. Discovery of DNA Rosalind Franklin used X-ray diffraction to get information about the structure of DNA. She aimed an X-ray beam at concentrated DNA samples and recorded the scattering pattern of the X-rays on film.

17. The Double Helix –Using clues from Franklin’s pattern, James Watson and Francis Crick built a model that explained how DNA carried information and could be copied.

19. Shape of DNA: Double Helix

20. Double helix: Double (2) stranded, twisted ladder

21. Rails of ladder – formed by the “sugar-phosphate backbone” –alternating deoxyribose sugar and phosphates

22. Steps of ladder - formed by nitrogenous base pairs (A, T, G, C) complimentary –two strands of the ladder are “complimentary” to each other. (they go together)

23. RNA: ribonucleic acid RNA: ribonucleic acid RNA is used to take DNA info outside the nucleus to be used by cell – Structure single RNA is a single strand ribose RNA has ribose instead of deoxyribose Uracil RNA uses Uracil instead of Thymine

24. Learning Goals 1. What is the primary job of DNA? Why are genes important? 2. Describe the structure of DNA. (Include the 3 parts of a nucleotide) 3. Explain the base pairing rules. 4. Describe the parts of a DNA double helix 5. Compare & Contrast DNA & RNA (Give at least 2 similarities & 2 differences.