1. DNA and Protein Synthesis

2. Nucleic Acid Review

3. Name of the molecule identified by the arrow: 1.Phosphate group 2.Nitrogen base 3.Adenine 4.Sugar

4. Name given to the circled structure: 1.Nucleic acid 2.Amino acid 3.Nucleotide 4.Nucleus

5. The type of reaction responsible for joining molecules A and B A B 1.Hydrolysis 2.Dehydration

6. Let’s assume the following strand of DNA contains the information needed to make a protein. This segment of DNA is known as a____: 1.Nucleotide 2.Codon 3.Translation 4.Gene 5.mRNA

7. Which is single stranded? 1.DNA 2.RNA

8. Which one can exit the nucleus? 1.DNA 2.RNA

9. The two strands of DNA are bonded together in the middle by their… 1.Sugars 2.Phosphates 3.Nitrogen bases

10. Which one contains nitrogenous bases A, T, G and C? 1.DNA 2.RNA

11. DNA is … 1.Single stranded 2.Double stranded 3.Triple stranded

12. Every nucleotide is made up of… 1.Sugar 2.Phosphate 3.Nitrogen base 4.All of the above

13. Nucleic Acids - Function Control the processes of heredity by which cells and organisms reproduce proteins.

14. Nucleic Acids – Types DNA –Deoxyribonucleic Acid RNA –Ribonucleic Acid

15. Do you remember DNA structure? SUGAR Phosphate

16. Let’s build on that knowledge…

17. Protein Synthesis It’s a process –DNA -> RNA -> Amino Acids (Protein)

18. RNA Sugar is Ribose NOT what… Has nitrogen base Uracil instead of Thymine –Also contains the other 3 bases…what are they? Only single stranded

19. RNA

20. Three processes in this unit… 1. Replication (DNA  DNA) 2. Transcription (DNA  mRNA) 3. Translation (RNA  Protein)

21. A. DNA Replication 1.Occurs in the nucleus prior to any cell division 2.Enzyme is used to “unzip” or “unwind” the DNA a.Forms a bubble at the origin site

22. DNA Replication (cont.) 3.Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA a.Nitrogenous bases pair up 1.A – T 2.C - G 4.As a result, you create two identical strands of DNA

23. Let’s Practice Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG

24. Let’s Build A Protein

25. Transcription 1.) DNA strand unzips –The bonds between the nitrogen bases are broken –Initiated by RNA polymerase (enzyme) binding to promoter site on DNA 2.) A single strand of mRNA (messenger RNA) is made –Pair up the bases A  T  C  G  The mRNA then travels from nucleus to cytoplasm

26. Transcription

27. Where in the cell does transcription take place? 1.Cytoplasm 2.Mitochondria 3.Nucleus 4.Golgi Body 5.Vacuole

28. Any given segment of DNA has directions that make unique what? 1.Glucose 2.Proteins 3.Lipids 4.Blood cells

29. If a DNA strand has the following sequence of base pairs – A C T G G T C C A A, then the mRNA strand would have what sequence? 1.T G A C C A G G T T 2.A C T G G T C C A A 3.T G U C C U G G T T 4.U G A C C A G G U U

30. Why is mRNA called messenger RNA? Because it carries the directions to make a protein to the ribosome like a message

31. Actually 3 types of RNA mRNA- messenger –Brings message from nucleus to ribosomes in cytoplasm rRNA- ribosomal –Make up a ribosome tRNA- transfer –“transfers” amino acids from the cytoplasm to the ribosome to be added to the chain

32. The difference between RNA and DNA is what? 1.The phosphates 2.The sugars 3.The nitrogen bases 4.The way the monomer units bond

33. mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? 1.Mitochondria 2.Ribosome 3.Golgi Body 4.Lysosome 5.Nucleus

34. Translation 1. mRNA meets up with a ribosome…why?? –Ribosomes are the site for protein production 2. tRNA molecules bring amino acids to ribosomes 3. An mRNA codon will pair with a tRNA anticodon –Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid –Anticodon: 3 Nitrogen base sequence in tRNA

35. Translation (cont.) 4.As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.

36. That’s the process, Now how do you know what amino acids make up a particular protein We use an mRNA codon chart

37. Where in the cell does transcription, the first part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Ribosomes 4.Cytoplasm 1234567891011121314151617181920 2122232425262728

38. DNA has the directions to make what? 1.Glucose 2.Nucleotides 3.Proteins 4.Monosaccharides 1234567891011121314151617181920 2122232425262728

39. After a strand of mRNA is made where does it go? 1.Ribosome 2.Mitochondria 3.Lysosome 4.Vacuole 1234567891011121314151617181920 2122232425262728

40. Where in the cell does translation, the second part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Golgi body 4.Cytoplasm 1234567891011121314151617181920 2122232425262728

41. Molecules called tRNA’s are floating around the cytoplasm carrying what? 1.mRNA’s 2.Glucose 3.DNA 4.Nucleotides 5.Amino Acids 1234567891011121314151617181920 2122232425262728

42. An mRNA codon is made up of how many nitrogen bases? 1.1 2.3 3.6 4.24 1234567891011121314151617181920 2122232425262728

43. Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? 1.Phenylalanine 2.Glutamine 3.Asparagine 4.Lysine 5.Tyrosine 1234567891011121314151617181920 2122232425262728

44. What protein would be synthesized from the following mRNA strand? A C U U U C G A A U A C 1.Threonine – phenylalanine – glutamate – tyrosine 2.Phenylalanine – leucine – methionine – valine 3.Tyrosine – glutamate – phenylalanine – threonine 4.Lysine – cysteine – arginine – histidine 1234567891011121314151617181920 2122232425262728

45. What protein would be synthesized from the following DNA segment? T A A G T A C G C T A G 1.Isoleucine – alanine – histidine – alanine 2.Isoleucine – histidine – alanine – isoleucine 3.Phenylalanine – leucine – valine – arginine 4.Isoleucine – leucine – threonine – lysine 1234567891011121314151617181920 2122232425262728

46. How would you assess your comprehension of DNA and Protein Synthesis? 1.A 2.B 3.C 4.D 1234567891011121314151617181920 2122232425262728