Download presentation
Presentation is loading. Please wait.
Published byEric Flowers Modified over 9 years ago
1
Team Conoscenza Bioinformatics Tan Jian Wei ~ Tan Fengnan
2
Presentation Flow Background Problem Solution Technical Difficulties Milestones Questions
3
Background Technical Difficulties Milestones Questions Background Problem Solution Human Genome Project ◦ Began 1990 – Ended at 2004 ◦ Mapped out all of the Human Genome Sequences ◦ 20,000 – 25,000 “working” gene ◦ 3.3 Billion base pairs Adenine, Thymine, Guanine, Cytosine The base pairs will form proteins or hormones after a process known as “Transcription”
4
Background Part 2 Technical Difficulties Milestones Questions Background Problem Solution Why do we want to do that? ◦ We don’t actually know what this particular gene does. Useful gene denotes a functionality or a trait By comparing with isolated protein, we can find out where is exactly these genes are and does. Example: Insulin Insulin -> isolated from human Do a base pair match against a genome database of a plant Find out whether the plant can be candidate to produce a insulin substitute
5
Background Part 3 Technical Difficulties Milestones Questions Background Problem Solution How do we do this? ◦ United States National Center For Bioinformatics Information ◦ BLAST (Basic Local Alignment Sequencing Tool)
6
Background Part 4 Technical Difficulties Milestones Questions Background Problem Solution AACGTTTCCAGTCCAAATAGCTAGGC ===--=== =-===-==-====== AACCGTTC TACAATTACCTAGGC Hits(+1): 18 Misses (-2): 5 Gaps (existence -2, extension -1): 1 Length: 3 Score = 18 * 1 + 5 * (-2) – 2 – 2 = 6
7
Problem How do we process the information here? How do researchers make sense out of it? E.g. 7000 records Is there a better way to use the information here in a more aggregated context? Can this information be shared among other users? Technical Difficulties Milestones Questions Background Problem Solution
8
Solution To present the data in a way that is relevant to the bio informatics context Visualizing the data in a very intuitive way Technical Difficulties Milestones Questions Background Problem Solution
9
Technical Difficulties Deploying ex server Understanding what the terms in the data mean Transforming data into a useful format for analysis ◦ Have to first analyze researchers’ difficulty Technical Difficulties Milestones Questions Background Problem Solution
10
Milestones Wiki write up and proposal Testing current NCBI system Data cleaning Building Panopticon solution Deploying EX Server Technical Difficulties Milestones Questions Background Problem Solution
11
Questions Technical Difficulties Milestones Questions Background Problem Solution
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.