1. Anatomy and Physiology I Protein Synthesis and the Genetic Code Instructor: Mary Holman

2. Proteins Every cell contains large numbers of diverse proteins The proteins determine the physical and chemical characteristics of cells Much of cellular machinery is devoted to synthesizing proteins Instructions for making proteins are contained primarily in the DNA in the nucleus of the cell

3. Organic Compounds Proteins More complex than carbohydrates and lipids Have a larger range of functions : structural material, energy source, hormones, receptors, enzymes, antibodies Contain N as well as C, H, and O and some contain S Amino acids are the building blocks (monomers) of proteins There are twenty (20) different amino acids Amino acids bind together by forming peptide bonds

4. Fig. 2.17a HN H C H C O OH R The portion common to all amino acids is within the oval. It includes the amino group (—NH 2 ) and the carboxyl group (—COOH). The "R" group, or the "rest of the molecule," is what makes each amino acid unique. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. General structure of an amino acid

5. Fig. 2.17b S C H HH HN H C H C O OH C C C H H CH CH H CH CH HN H C H C O (b) Cysteine. Cysteine has an R group that contains sulfur. Phenylalanine. Phenylalanine has a complex R group. Improper metabolism of phenylalanine occurs in the disease phenylketonuria. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

6. Fig. 2.18 O OHCNCCNC ROH H H HHR Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. A Peptide Bond (H 2 O)

7. Fig. 2.19a Amino acids Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Primary Structure of Proteins Polypeptide chain

8. Pleated structure Coiled structure N N N N N H H H H C C C C O C C C C C O C O H N N H O O C C C C N NHO CC HOC H R H R R H R H R H R H R H R H C H C H Secondary Structure Three-dimensional folding Tertiary Structure Quaternary Structure Two or more folded chains may connect and fold together Ex: Hemoglobin molecule

9. Nucleic Acids Huge molecules that contain C, H, O, N and P Building blocks (monomers ) are nucleotides Nucleic acids are of two varieties Deoxyribonucleic acid (DNA) Ribonucleic acid (RNA)

10. Sugar P Base Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Basic Structure of a Nucleotide Fig. 2.20

11. OH HH HOCH 2 H CC O H CC H HH 2 OH H CC O H C C RiboseDeoxyribose Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Fig. 2.22 Different sugar groups of DNA and RNA

12. Nitrogenous Bases The two types of nitrogenous bases in nucleotides: Purines - structure of two joined organic rings Pyrimidines - have a single organic ring

13. Nitrogenous bases of DNA

14. DNARNA App. D Pg. 937 The Five Nitrogenous Bases

15. The Molecular Structure of DNA App. D pg 937

16. Fig. 4.19a GC G G A T C C A P GC P T P P C G P G P C P A P P P Thymine (T) Cytosine (C) Adenine (A) Guanine (G) Nucleotide strand Segment of DNA molecule (a) GC G G A T C C A P G C P T P P C G P G P C P A P P P Thymine (T) Cytosine (C) Adenine (A) Guanine (G) Hydrogen bonds Nucleotide strand Segment of DNA molecule Fig. 4.19a DNA

17. Fig. 4.19b Globular histone proteins Chromatin Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Fig. 4.19b The Double Helix Structure of DNA

18. Fig. 4.19c Metaphase chromosome Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNA as condensed Chromosome during Mitosis

19. Fig. 4.20b C C AT C CG G C C G C G A A T T CG C AT Newly formed DNA molecules Region of replication Original DNA molecule G G G G G G GG G CC C C CG Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNA Replication prior to Mitosis Fig 4.20 (partial)

20. S P S P S P S P S P S P B B B B B B S P S P S P S P S P S P B B B B B B S S S S S S P P P P P P B B B B B B Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Fig. 2.21 RNADNA

21. Fig. 4.21 S C S S S S G G G U A U U P P P P S S S S A P P U S P P P P RNA Differences from DNA RNA is single stranded contains ribose instead of deoxyribose contains uracil instead of thymine there are different types of RNA - all with unique roles

22. Steps in Relaying the Genetic Information Stored in DNA to Proteins to be Synthesized Transcription - in nucleus mRNA copies the DNA sequence mRNA enters cytoplasm and arrives at a ribosome Translation - on ribosome in cytoplasm tRNA matches its anticodon to codons on mRNA and delivers the corresponding amino acid. The polypeptide chain of a new protein is assembled on the ribosome

23. Fig. 4.22 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNAmRNA S G S C S S S S C G T A S S S S G C A U Direction of “reading” code P P P P P P P P P P Transcription by RNA from DNA bases

24. Fig. 4.23a 1 2 Cytoplasm DNA double helix Nucleus Messenger RNA A T A A T T T AT AT AT AT AT UA UA UA G C C GC GC G C GC GC G C G G C C GC CG U A CG C G G G G G G G G G G C C C C C C C C C C A A A A A T TA AT AT AT AT CG GC GC GC TA TA TA CG AT GC TA CG TA CG CG GC AT TA CG GC T T G CG CG CG CG CG CG CG C G DNA strands pulled apart Messenger RNA DNA information is copied, or transcribed, into mRNA following complementary base pairing Nuclear pore mRNA leaves the nucleus and attaches to a ribosome Transcription (in nucleus) DNA strand G C CG A G G C U C T C C G A G Transcription 1 2

25. Fig. 4.23b mRNA leaves the nucleus and attaches to a ribosome Translation begins as tRNA anticodons recognize complementary mRNA codons, thus bringing the correct amino acids into position on the growing polypeptide chain As the ribosome moves along the mRNA, more amino acids are added At the end of the mRNA, the ribosome releases the new protein tRNA molecules can pick up another molecule of the same amino acid and be reused Polypeptide chain Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 3 2 4 5 6 Amino acids attached to tRNA Fig 4.23b Translation Cytoplasm

26. Fig. 4.24a Messenger RNA Transfer RNA Next amino acid Anticodon Codons Growing polypeptide chain 1 1 2 2 3 3 4 4 5 5 6 6 7 CUGCGU UCGGAAAAAAGGGGGGGGCCCCCCCUU The transfer RNA molecule for the last amino acid added holds the growing polypeptide chain and is attached to its complementary codon on mRNA. 1 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

27. Fig. 4.24b Messenger RNA Transfer RNA Next amino acid Anticodon Codons 1 1 2 2 3 3 4 4 5 5 6 6 7 CUGCGU Peptide bond UCGGAAAAAAGGGGGGGGCCCCCCCUU 2 A second tRNA binds complementarily to the next codon, and in doing so brings the next amino acid into position on the ribosome. A peptide bond forms, linking the new amino acid to the growing polypeptide chain. Growing polypeptide chain Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

28. Fig. 4.24c C U G G Messenger RNA Transfer RNA Next amino acid Ribosome 1 1 2 2 3 3 7 4 4 5 5 67 C C CGU 6 UCGGAAAAAAGGGGGGGGCCCCCCCUU The tRNA molecule that brought the last amino acid to the ribosome is released to the cytoplasm, and will be used again. The ribosome moves to a new position at the next codon on mRNA. 3 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

29. Fig. 4.24d CCGCGU Messenger RNA Transfer RNA Next amino acid 1 1 2 2 3 3 4 4 5 5 67 6 7 UCGGAAAAAAGGGGGGGGCCCCCCCUU A new tRNA complementary to the next codon on mRNA brings the next amino acid to be added to the growing polypeptide chain. 4 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Alanine Glycine Serine Methionine

30. Step 1

31. Fig. 4.23c Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. C Codon 1 Codon 2 Codon 3 Codon 4 Codon 5 Codon 6 Codon 7 G G G G G A A A U U C C C C C C G G G A Methionine Glycine Amino acids represented Serine Alanine Threonine Alanine Glycine mRNA

33. Fig. 4.25 Code for Glutamic acid Mutation Direction of “reading” code Code for valine (a)(b) S S S C T A P P P S S S C T T P P P Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. A single base Mutation DNA

34. Fig. 4.26 STARTING MATERIALS INTERMEDIATE #1 Enzyme #1 Enzyme #2 Enzyme #3 Enzyme #4 Enzyme #5 Enzyme #6 Enzyme #8 HEME Enzyme #7 ALA dehydratase deficiency acute intermittent porphyria congenital erythropoietic porphyria porphyria cutanea tarda coproporphyria erythropoietic protoporphyria porphyria variegata INTERMEDIATE #2 INTERMEDIATE #3 INTERMEDIATE #4 INTERMEDIATE #5 INTERMEDIATE #6 INTERMEDIATE #7 Resulting Conditions Consequences of mutations in enzymes in the synthesis of Heme