Presentation is loading. Please wait.

Presentation is loading. Please wait.

1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.

Similar presentations


Presentation on theme: "1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation."— Presentation transcript:

1 1 PROTEIN SYNTHESIS

2 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation

3 SCI.9-12.B-4.3 - [Indicator] - Explain how DNA functions as the code of life and the blueprint for proteins. SCI.9-12.B-4.4 - [Indicator] - Summarize the basic processes involved in protein synthesis (including transcription and translation). 3

4 Transcription – mRNA copying DNA, happens in the nucleus and mRNA must be edited or processed before it leaves the nucleus Translation – when mRNA goes to ribosome and tRNA brings the correct amino acids to the ribosome 4

5 5 DNA  RNA  Protein Central Dogma Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

6 6 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein

7 7 Nucleic Acids

8 8 RNA

9 9 RNA Differs from DNA 1.RNA has a sugar ribose DNA has a sugar deoxyribose 2.RNA contains the base uracil (U) DNA has thymine (T) 3.RNA molecule is single-stranded DNA is double-stranded

10 10. Three Types of RNA Messenger RNA (mRNA) carries genetic information to the ribosomesMessenger RNA (mRNA) carries genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized

11 11 Making a Protein

12 12 Genes & Proteins  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids exist  Amino acids chains are called polypeptides  Segment of DNA that codes for the amino acid sequence in a protein are called genes

13 13 Two Parts of Protein Synthesis  Transcription makes an RNA molecule complementary to a portion of DNA  Translation occurs when the sequence of bases of mRNA DIRECTS the sequence of amino acids in a polypeptide

14 SCI.9-12.B-4.3 - [Indicator] - Explain how DNA functions as the code of life and the blueprint for proteins. SCI.9-12.B-4.4 - [Indicator] - Summarize the basic processes involved in protein synthesis (including transcription and translation). 14

15 15 Genetic Code  DNA contains a triplet code  Every three bases on DNA stands for ONE amino acid  Each three-letter unit on mRNA is called a codon  Most amino acids have more than one codon!  There are 20 amino acids with a possible 64 different triplets  The code is nearly universal among living organisms

16 16

17 17 What is the enzyme responsible for the production of the mRNA molecule?

18 18 RNA Polymerase  Enzyme found in the nucleus  Separates the two DNA strands by breaking the hydrogen bonds between the bases  Then moves along one of the DNA strands and links RNA nucleotides together

19 19 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

20 20 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

21 21 Processing Pre-mRNA Also occurs in the nucleusAlso occurs in the nucleus Pre-mRNA made up of segments called introns & exonsPre-mRNA made up of segments called introns & exons Exons code for proteins, while introns do NOT!Exons code for proteins, while introns do NOT! Introns spliced out by splicesome- enzyme and exons re-joinIntrons spliced out by splicesome- enzyme and exons re-join End product is a mature RNA molecule that leaves the nucleus to the cytoplasmEnd product is a mature RNA molecule that leaves the nucleus to the cytoplasm

22 22 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

23 23 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

24 24 Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

25 SCI.9-12.B-4.3 - [Indicator] - Explain how DNA functions as the code of life and the blueprint for proteins. SCI.9-12.B-4.4 - [Indicator] - Summarize the basic processes involved in protein synthesis (including transcription and translation). 25

26 26 Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A

27 27 Translation Synthesis of proteins in the cytoplasmSynthesis of proteins in the cytoplasm Involves the following:Involves the following: 1.mRNA (codons) 2.tRNA (anticodons) 3.ribosomes 4.amino acids

28 28 Translation Three steps:Three steps: 1.initiation: start codon (AUG) 2.elongation: amino acids linked 3.termination: stop codon (UAG, UAA, or UGA). Let’s Make a Protein !

29 http://highered.mcgraw- hill.com/olcweb/cgi/pluginpop.cgi?it=swf ::535::535::/sites/dl/free/0072437316/12 0077/micro06.swf::Protein%20Synthesi s 29

30 http://sciencenetlinks.com/interactives/pro tein.html 30

31 31 End Product –The Protein! The end products of protein synthesis is a primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bondsA sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

32 Types of Mutations 1.Point mutation – one DNA bases changes. Sometimes this mistake is corrected by an enzyme. 2.Frameshift mutation – insertion or deletion of a nucleotide (or base) changes the group of three bases that code for the amino acid ACT CAT TAG GAG (first T is deleted) ACC ATT AGG AG 32


Download ppt "1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation."

Similar presentations


Ads by Google