1. Phylogeographic history of the wild ancestor of the domesticated common bean (Phaseolus vulgaris L.) Maria Chacon February 14 2003

2. Plant domestication. Evolutionary history of wild relatives of our crops. Domestication history of the crop: single event? Multiple events? A single or multiple geographic regions?. Impact of domestication on genetic diversity. Analysis of the genetic basis of the domestication syndrome Our crops were selected under a human-driven process called domestication. Plant domestication is an evolutionary process by which conscious (and unconscious) human selection on certain useful characters result in changes in the population’s genotypic frequencies that make plants more useful to humans, better adapted to human environments and sometimes fully dependent on man for dispersion

3. Hunting and gathering Agriculture Highlands 10,000 years ago

4. Mesoamerican crops South American crops Cucurbita argyrospermaCucurbita ficifoliaCucurbita maximaCucurbita moschataCucurbita pepo Phaseolus vulgaris small-seededPhaseolus vulgaris, big-seededPhaseolus lunatus. Lima type Capsicum frutescensCapsicum baccatumCapsicum annuumCapsicum pubescens Squashes Chilli peppers Beans

5. Isthmus of Tehuantepec Nicaraguan Depression Darien Gap Geographic distribution of wild common bean

6. Nama dichotomum Phacelia crenulata Phacelia magellanica Disjunct distributions of plant taxa in the Americas Family (Hydrophyllaceae)

7. The rise of the Isthmus of Panama: The Great American Biotic Interchange Moving into South America were 1) fox; 2) deer; 3) tapir; 4) spectacled bear; 5) spotted cat; and 6) llama. Flying north were 7) parrot; and 8) toucan. Following on foot were 9) armadillo; 10) giant sloth; 11) toxodont; 12) howler monkey; 13) paca; 14) giant predatory bird; 15) anteater; and 16) capybara.

8. Historical causes of disjunct biogeographic distributions Disjunct distributions are of interest because they demand an historical explanation: Dispersal and Vicariance 1.Dispersal: Species was present in only one area and was able to cross intervening barrier regions and colonize other areas. For example: climatic changes in the Pleistocene glaciations may have created “corridors” (with suitable climates) through which species could disperse to other areas. 2.Vicariance: changes in the position of continents, known as continental drift, or mountain building may have divided an originally continuous distribution. 3.In the case of wild relatives of domesticated plants, humans may have played a role in their distribution

9. Wild common bean may have a relatively recent history Population structure of the species may have been determined by recent historical events: 1.The species seems to have originated recently according to molecular clock calculations (Gepts and co-workers) that suggest an origin of the species at about 2 million years ago 2.The geological history of many of the units that wild beans occupy is a recent one, for example, many of them presented uplift and/or vulcanism in the Pleistocene (at about 2 million years ago). 3.The last glaciation in the Pleistocene (called the ice ages) caused global climatic change and ended about 10,000 years ago.

10. SierraMadreOccidental Trans-Mexican Volcanic Belt SierraMadredelSur Chiapas-Guatemala-Honduras Highlands TalamancanCordillera Eastern Cordillera of Colombia Central Andes of Colombia and Eastern Andes of Ecuador Cordillera Oriental of the Andes Geological units of Latin America where wild common bean is distributed

11. No fossil record of wild beans to indicate when or where P. vulgaris originated and directionality of expansion from Mesoamerica to South America or vice- versa Phylogeography reconstructs phylogenetic lineages from molecular data and provides a framework to test the processes that most likely have led to the present-day distribution of those lineages: range fragmentation, range expansion and long distance colonization Phylogeography Phylogeographic methods are based on associations on the geographic extent of alleles and their genealogical relationships

12. With DNA sequence variation or restriction site data we can build the evolutionary relationships among the different variants, alleles or haplotypes that occur within a species in the form of a gene tree or haplotype tree If the tree may be rooted one could indicate the direction or the temporal polarity of the mutation or changes Haplotype networks are a suitable way of representing the evolutionary relationships among alleles or haplotypes at the intraspecific level Phylogeography (cont.)

13. Most of the phylogeographic studies have focused on animals where sequences or RFLP data of the rapidly evolving mitochondrial genome are used to build phylogenies Phylogeographic studies in plants have been limited by the lack of an appropriate source of variation. The few examples in the literature have used chloroplast DNA but this molecule have not proved useful for all the taxa Phylogeography (cont.)

14. Objectives In this research, a genealogical approach was used to: 1.Understand the evolutionary history of the wild relative of an important crop: the common bean 2.Investigate the cause (s) of its current disjunct distribution

15. The common bean as a model 1. The common bean offers an opportunity to study the processes that shape the natural distribution of lineages in plants: it presents an interesting disjunct and intercontinental distribution 2. This is a species that was domesticated several times in different places along its range and so the role that humans played in its dispersal can also be investigated

16. Phylogeographic study I. Survey of chloroplast DNA polymorphisms II. Haplotype network: Built by using the method of Templeton, Crandall and Sing III. Nested cladistic analysis: Using the method developed by Templeton and co-workers IV. Proposed demographic processes in wild common bean

17. 1.Five individual plants of a representative sample of 158 accessions of wild common bean and 160 accessions of domesticated common bean from the Phaseolus germplasm collection held at CIAT were analysed 2.A survey of chloroplast DNA polymorphisms was conducted on 16 accessions and 10 non-coding chloroplast regions by sequencing. Seven regions showed polymorphisms I. Survey of chloroplast DNA polymorphisms Phylogeographic study

18. Large single copy (LSC) (from left to right): rpl16 intron, accD-psaI spacer trnL-trnF spacer, trnL intron trnT-trnL spacer, rps14-psaB spacer IR SSC LSC IR Small single copy (SSC): ndhA intron Approximate positions of the seven polymorphic chloroplast DNA regions based on the map of the chloroplast genome of Nicotiana tabacum.

19. 5. Accessions differing by one or more changes were assigned to different chloroplast haplotypes (16 in total) 5’- TCGATTGACTGCAT -TCAGTCTCC- 3’ 5’- TCGA TTAACTGCATTTCAGTTTCC -3’ TaqIMseIBsmI 3.Changes detected in the survey were of three sorts: point mutations conferring gain or loss of a restriction site (16), point mutations not detectable by any restriction enzyme (16) and indels (2) 4.A combination of sequencing and PCR-RFLP was used to genotype the whole sample

20. II. Haplotype network H = r= length of the recognition sequence (r= 1 for sequence data)  = 4N , N=effective population size,  =mutation rate n=number of haplotypes a. An absolute distance matrix is calculated b.The minimum number of mutational connections between haplotypes is calculated. H parameter from Hudson (1989) is calculated for a pair of randomly chosen haplotypes c.Haplotypes are connected via justified minimum connections in one or more networks Construction of a haplotype network: the method of Templeton, Crandall and Sing (1993) was used:

21. C K E F H G J LM          IAB      O D P  N P.costaricensis P.polyanthus 7 mutational steps 13 mutational steps 9 mutational steps    Tip haplotypes or younger Interior haplotypes or older

22. Tests of geographical associations of haplotypes were conducted following the procedures developed by Templeton and co- workers. III. Nested cladistic analysis next 1.The haplotypes in the network were grouped in a series of nested clades (design)design 2.D c, the clade distance, and D n, the nested clade distance, were calculated for each clade (example)example 3. The distributions of these two distances under the null hypothesis of no geographical associations within clades were determined by recalculating both distances after each of 1,000 random permutations of clades against sampling locations. 4. These randomization procedures allows to test for significantly large and small distances (both D c and D n ) with respect to the null hypothesis

23.     O K J LM    I  E F HG     C    AB P D 1 - 1 1 - 2 1-3 1-4 1 - 5 1-6 1-7 1-81-9 1-13 1-15 1 - 14 2-1 2-2 2-3 2-4 2-5 2-6 3-1 3-2 3-3  N 2-7 1-16 1-11 1-10 1-12 Close The nesting arrangement resulted in a total of 26 hierarchically arranged clades, with higher level nesting correlating with more distant evolutionary time

24. A A A A A A A A great circle distance is the length of the SHORTEST arc on the surface of the Earth connecting two locations. A B B B B B B B B A a1a1 a2a2 a3a3 a4a4 a5a5 a8a8 a7a7 a6a6 a9a9 B b1b1 b2b2 b3b3 b4b4 b5b5 b8b8 b7b7 b6b6 b9b9 1-1 A9A9 A5A5 A6A6 A4A4 A7A7 A3A3 A2A2 A1A1 A1A1 B9B9 B1B1 B2B2 B3B3 B4B4 B5B5 B6B6 B7B7 B8B8 D c A=D c B=D n A= D n B= Great circle distances of hapotypes and clades Close

25. Under coalescent theory, different demographic models have different expectations regarding the relationship between the genealogical and geographical distances between haplotypes Contemporary factors Restricted gene flow with isolation by distance. Significantly small D c s for tip clades and large D c s for interior clades. Historical population events Past population fragmentation. Small D c s for both tip and interior clades. Significant restriction of D c s at high level clades Range expansions. Large D c s and D n s for tip clades. Small D c s for some interior clades. Long distance colonization. Small D c s for some tip clades. Patterns of D c and D n distances for tip and interior clades are characteristic of different demographic models:

26.              1-2 1-3 1-4 1-5 1-6 1-7 1-8 1-9 1-10 1-11 1-12 1- 13 1- 15 1 - 14 2-1 2-2 2- 3 2- 4 2-5 2-6 3-1 3-2 3-3  2-7 1 - 16  Mutational step  Inferred haplotype   1-1  P C D N O F E G H J LM IK 1-step clades 2-step clades 3-step clades Observed haplotype BA Geographic distribution of haplotypes and evolutionary relationships

27. IV. Proposed demographic processes in wild common bean

28. Disjunct distribution of haplotype A: a biogeographical problem that deserves further study  1-2 1-3 2-1    1-1  P C D BA Dispersion by humans? Convergent evolution? Short-distance dispersal followed by extinction in the intermediate area? Direction of dispersal, north to south or south to north? Haplotypes in domesticated beans C I K L Haplotypes in wild beans

29. Range expansion across current natural barriers: the Isthmus of Tehuantepec in Mesoamerica and the Nicaraguan depression and Darien Gap in Central America    1-10 1-11 1-12 1- 13 2 - 4 2-5 3-3 J LM IK Tehuantepec Nicaraguan Depresion Darien Gap

30. Dispersion from northern Andes to Central America: Contiguous range expansion or long distance colonization?      1-4 1-5 1-6 1 - 7 2-2 2- 3 3-2 F E G H Fragmentation or isolation by distance of clade 2-3? Lack of sampling or extinctions in Central America?

31. 0.62-0.75 0.75-0.87 > 0.87 Probability scale Nicaragua Costa Rica Panama Honduras Climates suitable for wild beans in Central America. The probability scale reflects increasing likelihood of wild beans occurring in these areas. Open circles indicate accessions included in this study. Filled circles indicate accessions not included in this study.

32. Conclusions. At least three dispersion events may have been taken place: One from Mesoamerica to northern South America (clade 3-3), another one from northern South America to Central America (clade 3-2) and a third one between Mesoamerica and South America of uncertain direction (haplotype A). Much of the early history of the species is missing as suggested by deep positions of missing intermediate haplotypes within the network. Lack of sampling and extinctions may explain the absence of these haplotypes in the sample

33. Acknowledgments Dr Barbara Pickersgill, School of Plant Sciences, University of Reading, England Dr Daniel Debouck, Genetic Resources Unit, CIAT, Colombia COLCIENCIAS, Colombia for funding this research