1. Genetics: Gene Mutations and DNA Repair

2. INTRODUCTION
The term mutation refers to a heritable change in the genetic material
Mutations provide allelic variations
On the positive side, mutations are the foundation for evolutionary change
E.g. Light skin in high latitude human populations
On the negative side, mutations are the cause of many diseases
E.g. Hemophilia

3. DNA Maintenance Mutation rate are extremely low
1 mutation out of 109 nucleotides per generation

4. CONSEQUENCES OF MUTATIONS
Mutations can be divided into three main types
1. Chromosome mutations
Changes in chromosome structure
2. Genome mutations
Changes in chromosome number
3. Single-gene mutations
Relatively small changes in DNA structure that occur within a particular gene
Type 3 will be discussed in this set of lecture notes

5. Gene Mutations Change the DNA Sequence
A point mutation is a change in a single base pair
It involves a base substitution
5’ AACGCTAGATC 3’
3’ TTGCGATCTAG 5’
5’ AACGCGAGATC 3’
3’ TTGCGCTCTAG 5’
A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine
A transversion is a change of a pyrimidine to a purine or vice versa
Transitions are more common than transversions

7. Sickled red blood cells 10 μm 10 μm
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
© Phototake/Alamy
© Phototake/Alamy
Normal red blood cells
Sickled red blood cells
10 μm
10 μm
(a) Micrographs of red blood cells
NORMAL
: NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – GLUTAMIC ACID – GLUTAMIC ACID...
SICKLE
CELL
: NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – VALINE– GLUTAMIC ACID...
(b) A comparison of the amino acid sequence between normal b-globin and sickle-cell b-globin

8. Deletion of four base pairs Addition of four base pairs
Mutations may also involve the addition or deletion of short sequences of DNA
5’ AACGCTAGATC 3’
3’ TTGCGATCTAG 5’
5’ AACGCTC 3’
3’ TTGCGAG 5’
Deletion of four base pairs
5’ AACGCTAGATC 3’
3’ TTGCGATCTAG 5’
5’ AACAGTCGCTAGATC 3’
3’ TTGTCAGCGATCTAG 5’
Addition of four base pairs

9. Gene Mutations Can Alter the Coding Sequence Within a Gene
Mutations in the coding sequence of a structural gene can have various effects on the polypeptide
Silent mutations are those base substitutions that do not alter the amino acid sequence of the polypeptide
Due to the degeneracy of the genetic code
E.g. AUU to AUC still codes for Ile
Missense mutations are those base substitutions in which an amino acid change does occur
Example: Sickle-cell anemia
If the substituted amino acid does not affect protein function (as measured by phenotype), the mutation is said to be neutral

10. Nonsense mutations are those base substitutions that change a normal codon to a termination codon
Frameshift mutations involve the addition or deletion of nucleotides in multiples of one or two
This shifts the reading frame so that a completely different amino acid sequence occurs downstream from the mutation

12. Gene Mutations and Their Effects on Genotype and Phenotype
In a natural population, the wild-type is the most common genotype (may be encoded by a dominant or recessive allele)
A forward mutation changes the wild-type genotype into some new variation
If it is beneficial, it may move evolution forward
Otherwise, it will be probably eliminated from a population
A reverse mutation has the opposite effect
It is also termed a reversion (changes mutant back to wild-type)

13. Some mutations are called conditional mutants
Mutations can also be described based on their effects on the wild-type phenotype
When a mutation alters an organism’s phenotypic characteristics, it is said to be a variant
Variants are often characterized by their differential ability to survive
Deleterious mutations decrease the chances of survival
The most extreme are lethal mutations
E.g. Homozygous polydactyly in cats
Beneficial mutations enhance the survival or reproductive success of an organism
Some mutations are called conditional mutants
They affect the phenotype only under a defined set of conditions (such as temp affecting wild type and mutant bacteria)

15. Suppressor mutations are classified into two types
A second mutation will sometimes affect the phenotypic expression of another
These second-site mutations are called suppressor mutations or simply suppressors
Suppressor mutations are classified into two types
Intragenic suppressors
The second mutant site is within the same gene as the first mutation
Intergenic suppressors
The second mutant site is in a different gene from the first mutation

16. Gene Mutations in Non-coding Sequences
These mutations can still affect gene expression
A mutation, may alter the sequence within a promoter
Up promoter mutations make the promoter more like the consensus sequence
They may increase the rate of transcription
Down promoter mutations make the promoter less like the consensus sequence
They may decrease the rate of transcription
Probably responsible for most differences between closely-related organisms (e.g. humans and chimps)
A mutation can also alter splice junctions in eukaryotes

17. (3'-UTR) is the section of messenger RNA (mRNA) that immediately follows the translation termination codon.
16-13
Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display

18. Mutations Due to Trinucleotide Repeats
Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE)
The term refers to the phenomenon that a sequence of 3 nucleotides can increase from one generation to the next
These diseases include
Huntington disease (HD)
Fragile X syndrome (FRAXA)

20. Certain regions of the chromosome contain trinucleotide sequences repeated in tandem
In normal individuals, these sequences are transmitted from parent to offspring without mutation
However, in persons with TRNE disorders, the length of a trinucleotide repeat increases above a certain critical size
It also becomes prone to frequent expansion
This phenomenon is shown here with the trinucleotide repeat CAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
n = 11
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
n = 18

21. In some cases, the expansion is within the coding sequence of the gene
Typically the trinucleotide expansion is CAG (glutamine)
Therefore, the encoded protein will contain long tracks of glutamine
This causes the proteins to aggregate with each other
This aggregation is correlated with the progression of the disease
In other cases, the expansions are located in noncoding regions of genes
These expansions are hypothesized to cause abnormal changes in RNA structure
Thereby producing disease symptoms

22. Changes in Chromosome Structure Can Affect Gene Expression
A chromosomal rearrangement may affect a gene because the break occurred in the gene itself
A gene may be left intact, but its expression may be altered because of its new location
This is termed a position effect
Movement may be next to a regulatory sequence or into
into a heterochromatic region and now expressed.

23. Regulatory sequences are often bidirectional
Figure 16.2

24. Mutations Can Occur in Germ-Line or Somatic Cells
Geneticists classify the animal cells into two types
Germ-line cells
Cells that give rise to gametes such as eggs and sperm
Somatic cells
All other cells
Germ-line mutations are those that occur directly in a sperm or egg cell, or in one of their precursor
Somatic mutations are those that occur directly in a body cell, or in one of its precursor cells

25. The size of the patch will depend on the timing of the mutation
The earlier the mutation, the larger the patch
An individual who has somatic regions that are genotypically different from each other is called a genetic mosaic
Therefore, the mutation can be passed on to future generations
Therefore, the mutation cannot be passed on to future generations
Figure 16.4

27. OCCURRENCE AND CAUSES OF MUTATION
Mutations can occur spontaneously or be induced
Spontaneous mutations
Result from abnormalities in cellular/biological processes
Errors in DNA replication, for example
Induced mutations
Caused by environmental agents
Agents that are known to alter DNA structure are termed mutagens
These can be chemical or physical agents
Refer to Table 16.4

29. Spontaneous Mutations Are Random Events
Are mutations spontaneous occurrences or causally related to environmental conditions?
This is a question that biologists have asked themselves for a long time 
Jean Baptiste Lamarck
Proposed that physiological events (e.g. use and disuse) determine whether traits are passed along to offspring
Charles Darwin
Proposed that genetic variation occurs by chance
Natural selection results in better-adapted organisms

30. Random Mutations Can Give an Organism a Survival Advantage
Joshua and Ester Lederberg were also interested in the relation between mutations and the environment
At that time (1950s), there were two new theories
Directed mutation theory
Selected conditions could promote the formation of specific mutations allowing the organism to survive
This was consistent with Lamarck’s viewpoint
Random mutation theory
Environmental factors simply select for the survival of those individuals that happen to possess beneficial mutations
This was consistent with Darwin’s viewpoint

31. Causes of Spontaneous Mutations
Spontaneous mutations can arise by three types of chemical changes
1. Depurination
2. Deamination
3. Tautomeric shift
The most common

32. Causes of Spontaneous Mutations
Depurination involves the removal of a purine (guanine or adenine) from the DNA
The covalent bond between deoxyribose and a purine base is somewhat unstable
It occasionally undergoes a spontaneous reaction with water that releases the base from the sugar
Fortunately, these can be repaired
However, if the repair system fails, a mutation may result during subsequent rounds of DNA replication

33. Figure 16.8 Spontaneous depurination
Three out of four (A, T and G) are the incorrect nucleotide
There’s a 75% chance of a mutation
Spontaneous depurination
Figure 16.8

34. Deamination involves the removal of an amino group from the cytosine base
The other bases are not readily deaminated
Figure 16.9
DNA repair enzymes can recognize uracil as an inappropriate base in DNA and remove it
However, if the repair system fails, a C-G to A-T mutation will result during subsequent rounds of DNA replication

35. Deamination of 5-methyl cytosine can also occur
Figure 16.9
Thymine is a normal constituent of DNA
This poses a problem for repair enzymes
They cannot determine which of the two bases on the two DNA strands is the incorrect base
For this reason, methylated cytosine bases tend to create hot spots for mutation

36. A tautomeric shift involves a temporary change in base structure
These rare forms promote AC and GT base pair
For a tautomeric shift to cause a mutation it must occur immediately prior to DNA replication

37. Common
Rare
Figure 16.10

38. Figure 16.10

39. Shifted back to its normal fom Temporary tautomeric shift
Figure 16.10
16-42

40. Types of Mutagens
An enormous array of agents can act as mutagens to permanently alter the structure of DNA
The public is concerned about mutagens for two main reasons:
1. Somatic mutagens are often involved in the development of human cancers
2. Germ-line mutations may have harmful effects in future generations
Mutagenic agents are usually classified as chemical or physical mutagens

41. 16-53
Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display

42. Nonionizing radiation
Includes UV light
Has less energy
Cannot penetrate deeply into biological molecules
Causes the formation of cross-linked thymine dimers
Thymine dimers may cause mutations when that DNA strand is replicated
Figure 16.15

43. Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at

44. DNA Repair
All species have a variety of DNA repair systems to avoid the harmful effects of mutations.
Excision repair recognizes and removes a damaged base or damaged segments of DNA.
Base mismatch repair recognizes a base mismatch and removes a segment of the DNA strand with the incorrect base.

45. Mismatch Repair

46. Excision Repair

47. DNA polymerase replaces missing or damaged bases.

48. Mutant Hemoglobin Lab

50. RNAi Lab