1. Thomas R. Insel, M.D. Director, NIMH Recovery : How Research Will Change Practice June 13, 2008

2. Noah – 36 months in a life Number of outpatient providers: 80 Number of inpatient admissions:19 Number of inpatient diagnoses:22 Number of outpatient visits: 326 Methadone and cocaine overdose: 7/28/06 Number of ER visits84

3. Noah – 36 months in a life Number of outpatient prescriptions: 245 Methadone and cocaine overdose: 7/28/06 Number of psychotropic meds20 Insurance bill for inpt + outpt care $235K Cost of outpatient medications: $19K

4. Consumer CMHC SMHA M.H. Care M.D. Meds Housing Income Support Job Support Case Mgt. PHA V.R. Medicare Medicaid State Medicaid Agency HUD CMHS Education SSA “Coordination” of Mental Health Services in the U.S. Hogan, 2002

5. Direct and indirect components of the economic burden of serious mental disorders, excluding incarceration, homelessness, comorbid conditions and early mortality. ($ in billions) 1992 2002 Health Care Expenditures$62.91 $100.12 Loss of earning $76.71 $193.23 Disability (SSI + SSDI) $16.41 $24.34 Totals$156.0 B $317.6 B Resources Matched with Public Health Need Insel, Am J Psychiatry, 2008

6. Disparities in Mental Health Care Race/EthnicityNot Receiving Minimally Adequate Treatment, Among Those with SMI OR Non-Hispanic black 3.3* Non-Hispanic white1.0 Hispanic0.8 Other3.6 Adjusted for age, sex, income level, education, urbanicity, region of the country, employment status, and marital status. Wang et al. Am J Public Health 2002

7. Over 30,000 suicides per year (in the U.S.) - 90% related to mental illness Mental Disorders: Mortality For context: 18,000 homicides 20,000 AIDS deaths only 3 forms of cancer > 30,000

8. Public Health Impact: Early Mortality in Individuals with Major Mental Illness (MMI) Adapted from Colton and Manderscheid, 2006, Prev Chronic Dis Data from outpatient and inpatient clients diagnosed with MMI Average age at time of death : 56 years Increased likelihood of dying from suicide Medical co-morbidities

9. Where is the problem??? Family??? The Patient??? The system???The doctors??? Pharmaceutical companies??? Insurance companies??? Stigma??? The Illness

10. Disruptive Innovations For Preemption and Recovery Mental disorders are brain disorders. Mental disorders are developmental disorders. Current treatments may be necessary but not sufficient for recovery. Mental disorders result from complex genetic risk plus experiential factors.

11. PNAS, 2007 Mental disorders as brain disorders

12. Brain differences associated with depression Cg25 Area 25 – altered metabolism and 39% (bipolar) and 48% (unipolar) reduced grey matter volume Drevets et al., Nature, 1997

13. Affect in Subgenual Cingulate (BA25) Mayberg et al. Am J Psych 156:675-82 1999 increased CBF/Met’b decreased CBF/Met’b Depressed Affect R Cg25 Prefrontal 9 Cg25 Depression Recovery Cg25 Prefrontal 9

14. SSRI  Cg25 Placebo TMS ECT NoblerGeorgeMayberg Critical Role of Subcallosal Cingulate Cg25 SNRI Kennedy  Cg25 activity Mayberg Sad Memory Tryptophan Deplete SERT SS<LL MRI Depression:  Glia MaybergTalbot PezewasOngur Pre-CGT (FDG) Pre-DBS (CBF) Med NR (fMRI)  Cg25 activity DoughertyMayberg Greicius CBT/Med NR (FDG) Mayberg Bailey, Ballentine, Hunter-Brown, Laitenen Ablation Targets

15. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Current treatments may be necessary but not sufficient for recovery. Mental disorders result from complex genetic risk plus experiential factors.

16. Lancet Neurol 2007 Alzheimer’s: A Developmental Disorder?

17. Genetic risk Unusual thought content Suspicion/paranoia Social impairment History of substance abuse 68-80% prediction Arch Gen Psych, 2008 Schizophrenia: A Developmental Brain Disorder

18. Progressive Brain Structural Changes Mapped as Psychosis Develops in “At Risk” Individuals Sun et al, Schiz Res., 2008

19. Schizophrenia Trajectory Stage 1: Presymptomatic, Risk factors, Cognitive deficit with challenge [< Age 15] Stage 2: Prodrome, cognitive deficits emerging, minor disability Stage 3: Psychosis, acute disability, family costs [Age 18 – 24] Stage 4: Chronic illness, medical complications, social costs [> Age 24] 1988 2008 2018 [Age 15 – 18]

20. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Current treatments may be necessary but not sufficient for recovery. Mental disorders result from complex genetic risk plus experiential factors.

21. The Genomics Revolution Human Genome Project (2003) Mapped 3 billion bases of DNA in human genome …CTAGGCTTAAGCGGACCTGCTCTAGGTCAGTC…. Human HapMap Project (2005) Mapped all the common variations in the human genome …CTAGGCTTAAGCGTACCTGCTCTAGCTCAGTC…. 3 million common Single Nucleotide Polymorphism (SNP) Structural Variations in the Genome (2007) …CTAGGCTTAGGCTTAGGCTTAGGCTTAAGCG GACCTGCTCTAGGTCAGTC….

22. 200520062007 first quarter 2007 second quarter 2007 third quarter 2007 fourth quarter February 2008 Manolio, Brooks, Collins, in press.

23. Why does genomics matter? Genes are not going to yield a diagnostic test Genes are not going to identify a cause But Genetic variation can identify risk Genes can reveal mechanisms of disease Thus, genes can point to new targets for prevention and treatment

24. Pathways to Pathophysiology Meyer-Lindenberg & Weinberger, Nature Rev Neurosci, 2007

25. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Current treatments may be necessary but not sufficient for recovery. Mental disorders result from complex genetic risk plus experiential factors.

26. Current Treatments: How Good? CATIE (chronic schiz) STEP-BD (Bipolar) STAR*D (MDD) Real world setting Recovery of function Practical questions 10,000 patients, 200 sites, 3 diseases, practical trials

27. Schizophrenia: 74% discontinuation of anti- psychotics, limited access to psychosocial Rxs Depression: 31% remitted at 14 weeks, 67% at 1 year, limited access to CBT Bipolar: 21% stable for 8 weeks in first 6 months, high rates of medical co-morbidity Childhood disorders: dx prevalence increase 10- fold for autism, 40-fold for bipolar, no selective meds and few proven behavioral approaches Current Treatments: How Good?

28. Practical Trials – What Did We Learn? We can optimize care in real world settings With optimized care, outcomes are not optimal Current treatments help too few people get better and very few get well

29. Research For Recovery Pathophysiology (genes to cells to circuits to behavior/cognition and back) Trajectory of mental disorders (predictive biomarkers, individual risk) New interventions (rational, preemptive, personalized therapeutics) Participatory efforts (reducing disparities, focus on recovery)

30. Then (1998) Mechanism: Chemical imbalance Treatment: First generation Diagnosis: Unitary Now (2008) Diagnosis: Categorical but co-morbid Mechanism: Brain circuit dysfunction Treatment: Second generation Imagine (2018) Diagnosis: Dimensional Mechanism: Genes to behavior Treatment: Personal & pre-emptive RESEARCH

31. www.nimh.nih.gov Research for Prevention, Recovery, and Cure