1. ALTERNATE MECHANISMS OF ABORTIVE INITIATION RESULTING IN THE FORMATION OF VERY LONG ABORTIVE TRANSCRIPTS Monica Chander and Lilian M. Hsu* Program in Biochemistry, Mount Holyoke College, South Hadley, MA.  -CTD - spacer interactions result in VLAT formation at DG203 OBSERVATIONS  The effect of deleting the  subunit only affected transcription from VLAT-producing promoter DG203.  Transcription of DG203 with  -CTD∆235 RNAP gave half the level of VLATs obtained with WT RNAP. The decrease in yield of VLATs (16-19 nt long) corresponded with a quantitative increase in full-length production.  The N25 and N25 anti promoters show no difference in transcription profile with WT and mutant RNAPs. The effect of deleting the  CTD domain on SP Fullcon was small. SP Pcon and SP mar transcribed very poorly with reconstituted WT and mutant RNAPs.  Thus,  CTD∆235 contact with the UP-element-like sequence present only in the DG203 spacer is responsible for 50% of the VLATs formed at this promoter.  The remaining VLATs, which are  CTD-independant are also refractive to GreB-mediated cleavage and rescue. We postulate that this population arises from ITCs that hyper-forward- translocate during the escape transition. ABSTRACT The E  70 dependent N25 promoter from phage T5 is rate limited at promoter escape during transcription initiation. Here RNA polymerase (RNAP) repeatedly initiates and aborts transcripts prior to escape giving rise to a distinct ladder of short RNAs from 2-11 nts. Mutations in the initial transcribed sequence (ITS) of N25 change the promoter escape process resulting in the release of long (up to 15 nt) and very long abortive transcripts (VLATs) up to 19 nts. VLATs are unusual in that 5’-end labeled transcripts do not appear to be subject to GreB-mediated cleavage and re-extension. In this regard, the VLATs are unlike the shorter abortive RNAs (≤15 nt) that result from backtracked Initial transcribing complexes (ITCs). We speculate that a fraction of the ITCs undergoing the initiation-elongation transition instead, hyper-forward-translocate to produce arrested transcripts that are not rescued by GreB. In support of this VLAT production was shown to require near-consensus - 35 and -10 hexamers with 17-bp spacing -- a requirement of strong RNAP-DNA interaction previously shown to contribute to abortive RNA formation. Further, spacer sequence composition plays a role such that a spacer element containing A/T tracts gives rise to higher levels of VLATs than one lacking A/T tracts. To investigate why this might be we tested the hypothesis that an A/T- rich block serves to capture the  -subunits as RNAP moves downstream during the escape transition. Transcription of a VLAT-producing template with  CTD∆235 RNAP gave half the level of VLATs while increasing full length RNA synthesis. This result indicates that  CTD contact with the spacer element during normal forward movement of RNAP traps a fraction of polymerase molecules at the promoter and causes transcription to be aborted. The afore-mentioned results indicate that there exists two populations of ITCs poised at the VLAT positions. This prompted a direct examination of the 3’-end cleavage activity at a 19-nt long VLAT in the presence of GreB. We again detected two distinct fractions of VLATs -- one that was refractive to GreB and thus not a product of backtracking, and the other that was susceptible. Overall our results point to three distinct mechanisms that result in the formation of VLATs which are discussed in a model below. N25 ITS mutations alter the pattern of abortive cycling OBSERVATIONS v Mutations in N25 ITS positions +3 to +10 increase abortive cycling to +19. v Abortive initiation at positions ≤15 results from backtracking of the ITC and misalignment of the nascent RNA in the active site. These RNAs can be cleaved and re-extended in the presence of GreB. v VLATs (16-19 nts) are not rescued by GreB suggesting that they are unlikely to result from backtracking of the ITC. OBSERVATIONS v Promoter elements with the most effect on VLAT formation are the -35 and -10 hexamers and the spacer separating them. These elements interact primarily with the sigma subunit of the holenzyme. v Mutating these promoter elements away from the consensus dramatically diminishes the levels of VLATs. v Thus strong interactions between the promoter and RNAP decrease the probability of promoter escape and increase the likelihood of abortive initiation. Space elements with A/T tracts show higher levels of VLATs DG203 -60 CCTCGAGAAATCATAAAAAATTTATTTGCTT TCAGGAAAATTTTTCTGTATAATAGATTC -1 Upcon NNAAAWWTWTTTTNNNAAANNN SP Fullcon AAAGTGTTAAATTGTGC SP Pcon TTTTTAAGCTTGGCGGT SP mar TATACTTGCCTGGGCAA OBSERVATIONS vThe probability of forming VLATs is significantly high at DG203, SP Fullcon and SP Pcon. The spacer element connecting the -35 and -10 hexamers in these promoters all contain A/T tracts. v By contrast, the probability of forming VLATs is significantly lower at SP mar. The spacer element in this promoter lacks A/T tracts. v How does the A/T-tract in the spacer element in DG203 contribute to VLAT formation? The A/T tract in DG203 closely resembles an UP element consensus sequence. We hypothesize that that this UP-element-like sequence traps the alpha subunit as RNA polymerase moves downstream during the escape transition leading to arrested transcription and the release of VLATs. Model for VLAT production OBSERVATIONS v 3’-end cleavage of the 19-nt long transcript was observed in the presence of GreB resulting in the production of cleavage products 2-10 nt in length. v Nevertheless, the level of 19-nt long RNA continually increased with time. v This result contrasts with that of a 3’-end labeled backtracked 15-nt long RNA which also shows cleavage products with GreB, BUT which is completely eliminated in the presence of GreB (data not shown). v Hence, we conclude that there are two populations of ITC 19 -- one that backtracks and can be acted upon by GreB, and the other that does not.