1. Use of tethering for axial confinement in optical tweezers Mark Cronin-Golomb Biomedical Engineering Tufts University

2. Outline Motivation Design of DNA tether Videos of untethered and tethered particles Confocal detection measurement system Demonstration of force measurement Future directions

3. Tethers and tweezers Microspheres tethered to each other (Chu) Backscattering from tethered bead as probe of DNA flexibility (Libchaber APL 73, 291 (1998)) Twisting polymers by applying torque to trapped particle (Bustamante Nature 424, 338 (2003), Ormos) Study of macromolecular motion (Gelles)

4. Use of low numerical aperture trapping lenses Trapping particles against glass slide Trapping against counterflow Trapping against gravity

5. Axial trapping is harder to achieve than transverse trapping Generalized Lorenz-Mie theory to find radiation pressure cross section C pr (z) and radiation pressure force F in terms of standard Mie scattering coefficients: K.F. Ren, G. Gréhan, and G. Gouesbet, Appl. Opt. 35, 2702 (1996)

6. Axial force with 1.25NA beam 1  m diameter polystyrene bead, 13mW 820nm wavelength trap

7. Axial force for 0.65NA beam

8. Beads in 0.65NA trap without tether

9. Comparison of original and tethered configurations NA 1.3 Trap Beam Bead Trap Beam Bead DNA 48k base pairs 31.5x10 6 Dalton

10. Experiment Details

11. No dCTP stop No dCTP stop 1. dNTPs – dCTP + biotin-dUTP + Klenow 2. + dCTP + digoxigenin-dUTP C | C | G | C | G | G | AGGTTACG TCCAATGCCCCGCCGCTGGA |||||||| G | G | G | C | A | U | DIG | C | C | C | G | C | C | G | G | GGGCGGCGACCTCGCGGGTT GCGCCCAA ||||||||A | G | U | biotin | C | Zimmermann and Cox, Nucleic Acids Research 22, 492 (1994) End labeling DNA for attachment to streptavidin and anti-digoxigenin

12. Tether construct Streptavidin Biotin DIG Goat anti-mouse IgG bead Mouse anti-DIG antibody Cover slip Modified from Meiners and Quake Phys. Rev. Lett. 84, 5014 (2000)

13. Frame sequence from tethered bead video 10  m

14. Tethered beads in 0.65NA trap Tracking Software implemented in IDL by Crocker and Weeks http://www.physics.emory.edu/~weeks/idl/ 10  m

15. Experiment Details: measurements

16. As the tweezer beam is moved back and forth, the probe bead lags behind. The bead is bright when the tweezer beam illuminates it. The confocal signal is highest when the tweezer beam is centered on the probe bead.

17. At large oscillation amplitudes the potential well splits

18. Theoretical Background x: trap position  : viscous drag  : tweezer spring constant a: amplitude of trap oscillation  : frequency of trap oscillation L(t): Brownian forcing function

20. Viscosity Image Viscosity distribution around A. pullulans imaged by raster scanning an optically trapped probe bead. This blastospore has a halo of the polysaccharide pullulan around it. Note the viscosity gradient.

21. Force Off Oscillating Laser Trap Probe Bead a r Force On Probe Bead a Oscillating Laser Trap

22. We can use confocal tweezers to measure forces applied to probe beads. Flow measurement is one example of force measurement Force Measurement

23. Force measurement An optically trapped microsphere is used as a probe for two-dimensional force imaging using scanning optics. A fluid viscosity map may be obtained simultaneously. Calibration is based on a single length measurement only: the oscillation amplitude a of the trap.

24. Transverse force on tethered bead

25. Further applications Fiber based sensor Laser in Detector and electronics Piezotransducer

26. Applications Photonic force microscope with retained probe bead Measurement of changes in tether properties with environment, e.g. with enzymes, buffer properties etc.

27. Array of tethered beads for actin network network generation and analysis From Christian Schmitz’ talk Actin

28. Conclusions Probe beads can be tethered to substrates to eliminate need for axial trapping, enabling use of low NA objectives. Measurements of viscosity and force can be made with tethered beads via confocal detection system References to confocal detection method:  Nemet, Shabtai, Cronin-Golomb, Opt. Lett. 27, 264 (2002)  Nemet, Cronin-Golomb, Opt. Lett. 27, 1357, (2002)  Nemet, Cronin-Golomb, Appl. Opt. 42, 1820 (2003)

29. Acknowledgements Boaz Nemet Joe Platko Support of Tufts University Bioengineering Center