Presentation is loading. Please wait.

Presentation is loading. Please wait.

Chromosome Gene DNA  So when a cell divides, the new cells have a complete set of DNA instructions.

Similar presentations


Presentation on theme: "Chromosome Gene DNA  So when a cell divides, the new cells have a complete set of DNA instructions."— Presentation transcript:

1

2 Chromosome Gene DNA

3  So when a cell divides, the new cells have a complete set of DNA instructions.

4 PROKARYOTES  Double stranded  Single ring  Found in cytoplasm  A-T  C-G EUKARYOTES  Double stranded  Double helix  Found in nucleus  A-T  C-G Nucleotide

5

6  DNA is read 5’ to 3’  Strand on the left 5’ TTCAGT 3’  Strand on the right 5’ ACTGAA 3’

7 PROKARYOTES  Begins at a single point in the chromosome  Proceeds in two directions until the entire chromosome is separated EUKARYOTES  Replication can be occurring at hundreds of places along the same DNA strand

8 What has to happen to the DNA strand first? Double stranded DNA must be separated! How does this happen? An enzyme called DNA Helicase breaks the hydrogen bonds between the strands! Enzymes help the double strand unwind

9 Nucleotide DNA Polymerase adds free nucleotides that pair up to the exposed original strand (using Base Pairing Rules!!!)

10 DNA Polymerase It can only add nucleotides if the previous nucleotide is correctly paired. If there is an error, it backtracks to make the correction.

11  During replication, existing DNA strands serve as templates for new complementary strands Parent (original) strand present in all daughter (new) strands

12 Remember --A-TC-G 5’ 3’ ATGGCGTCATGCTTAGATTA 3’ 5’ TACCGCAGTA 3’ 5’ CGAATCTAAT


Download ppt "Chromosome Gene DNA  So when a cell divides, the new cells have a complete set of DNA instructions."

Similar presentations


Ads by Google