Download presentation
Presentation is loading. Please wait.
Published byLawrence Perry Modified over 9 years ago
1
Matt Thomas Determining The Association Between the Thr92Ala Type 2 Deiodinase Polymorphism and Insulin Resistance in the Old Order Amish
2
Impact of Diabetes n n 17 Million in the U.S. Have Diabetes - -6.2% of the total population n n Sixth leading cause of death in 1999 n n Complications n n Total cost of diabetes was $98 billion in 1997
3
Prevalence of Diabetes
4
Type 2 Diabetes n n Also known as - -late onset diabetes - -non insulin dependent - -adult-type diabetes n n Develops later in life n n Comprises 90-95% of all diabetes cases n n Very heterogeneous
5
Normal Insulin Release and Action
6
Pathogenesis n n Insulin secretion - -Pancreatic β -cells fail to produce adequate insulin n n Insulin resistance - -Cells fail to respond properly to insulin n n Result: Hyperglycemia
7
Hyperglycemia n n Short-term - -Ketoacidosis n n Long-term - -heart disease - -stroke - -high blood pressure - -Blindness - -kidney disease - -amputations
8
Environment + Genetics n n Multifactorial disease n n Environmental factors - -Diet - -Physical activity n n Genetic factors - -Twin studies - -Type 2 diabetes is polygenic - -Candidate gene studies
9
“Thrifty Gene” hypothesis n n Human ancestors - -Periods of feast and famine - -Active lifestyles Improved energy storage n n Humans today - -Abundant diets - -Sedentary lifestyles Obesity and diabetes
10
Thyroid Hormones n n Role in regulation of the metabolic rate and energy balance - -i.e. hyper and hypo-thyroidism n n Stimulate the resting metabolic rate n n Drives glucose transporter-4 (GLUT4) transcription - -GLUT4 protein allows glucose uptake
11
Type 2 Deiodinase (DIO2) n n DIO2 metablolizes inactive thyroid hormone (T 4 ) into active thyroid hormone T 3 n n Deiodination occurs in fat and skeletal muscle I 3I 3’ OHOR I 5I 5’ I 3I 3’ OR I 55’ T3 (Active) T4 (Inactive) DIO2 HO
12
The DIO2 Gene n Chromosome position 14q24.3 -Chromosome 14 -Long arm -Region 24.3
13
Thr92Ala DIO2 Polymorphism n n Polymorphism - - A G transition at nucleotide 274 - -Threonine is substituted by Alanine at amino acid 92 n n Previous studies - -Used hyperinsulinemic-euglycemic clamp - -Thr92Ala strongly associated with decreased glucose disposal
14
Why Study the Old Order Amish (OOA)? n n OOA are a closed founder group n n Large families n n Nearly complete genealogies n n Homogeneous lifestyles n n Amish Family Diabetes Study began in 1995 - -Detailed phenotypic characterization Used OGTT DNA samples blood
15
Polymerase Chain Reaction (PCR) n n Genomic DNA extracted from blood samples n n Master mix: - -Taq polymerase, PCR buffer, MgCl 2, primers n n Ran samples 40 cycles in thermocycler n n Sense primer: - -5’ CTCAGGGCTGGCAAAGTCAAG 3’ n n Antisense primer: - -5’ CCACACTCTATTAGAGCCATTG 3’
16
n n A G transition at nucleotide 274 n n Transition introduces restriction site site - -Restriction enzyme: BsgI - -Digest PCR product with BsgI Restriction Fragment Length Polymorphism (RFLP) Analysis
17
n n Thr92 homozygote = One band (256 bp) n n Thr92Ala heterozygote = Three bands (256, 186 & 70 bp) n n Ala92 homozygote = Two bands (186 & 70 bp) RFLP Results 2.5% agarose gel
18
Sample Data n n Thr92 homozygote = 11 n n Thr92Ala heterozygote = 12 n n Ala92 homozygote = 22
19
Results n Screened 1269 (90%) of 1407 samples n Sample of OOA subjects was found to be in Hardy-Weinberg equilibrium (p=0.993)
20
Results (cont.) n Insulin secretion and insulin area under the curve (IAUC) are significantly lower for those having a higher prevalence of Ala92 n Total cholesterol is significantly higher for those having a higher prevalence of Ala92
21
Conclusion n n Results conflict with previous findings - -Vermont studies found decreased glucose disposal for Ala92 polymorphism n n Differences may be due to population differences - -Amish have physically active lifestyles - -Linkage disequilibrium n n Different evaluations of insulin resistance
22
Acknowledgements n n Dr. Francesco Celi n n Dr. Jordan Warnick n n Dr. Cynthia Klevickis
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.