Presentation is loading. Please wait.

Presentation is loading. Please wait.

Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst.

Similar presentations


Presentation on theme: "Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst."— Presentation transcript:

1 Cassie, Abbie, Marie

2 $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst

3 $2,000  If you were to fall down and scrape your hands, what would stop the bleeding? A. White Blood Cells B. Plasma C. Red Blood Cells D. Platelets

4 $4,000  Another Name for Red Blood Cells is: A. Erythrocytes B. Leukocytes C. Thrombocytes D. Anemia

5 $6,000  How does the shape of the sickle cells affect its movement? A. Makes it harder to move through vessels B. Slows down blood flow C. Stops blood flow D. All of the above

6 $8,000  A hematocrit tests what percentage of whole blood is made up of: A. Oxygen B. White Blood Cells C. Red Blood Cells D. Plasma

7 $10,000  Symptoms of SCD may include: A. Severe infection B. Longer life expectancy C. Bloating D. Both A and C

8 $20,000  Treatment for SCD may include: A. Antibiotics B. Chronic Transfusion Therapy C. Bone Marrow Transplant D. All of the above

9 $30,000  What is the function of hemoglobin? A. Carries Oxygen to body and CO ₂ to the lungs B. Carries Red Blood Cells to the body C. Carries White Blood Cells to enemies D. None of the above

10 $40,000  SCD: A. Is an infectious disease B. Can be inherited by one parent C. Must be inherited by two parents D. Both B and C

11 $50,000  How is the RNA molecule a “script” for protein production? A. mRNA is read by tRNA B. tRNA brings amino acids C. Amino acids match with 3 mRNA sequences at a time, creating a protein D. All of the above

12 $60,000  Change this DNA sequence into mRN TACCATTGAAAGCATATCGAATGATGG A. AUGACCCCCGUACAAACUACGUUCCGA B. AUGGUAACUUUCGUAUAGCUUACUACC C. AUGCGGCUUAUCUUUCUAUAUCUUCAG D. AUGGUAACUUUCGUGUAGCUUACUUAC

13 $70,000  What amino acid must all protein sequences start with? A. Thr B. Pro C. Val D. Met

14 $80,000  Valine is: A. Hydrophobic B. Hydrophilic C. Positive D. Both A and C

15 $90,000  What type of mutation is responsible for SCD? A. Point Mutation B. Frameshift Mutation C. SCD Mutation D. Hemoglobin Mutation

16 $100,000  The replacement of glutamic acid with valine causes proteins be shaped in a way that causes them to: A. Not move B. Stick together C. Run away from each other D. Cry

17 $200,000  SCD is: A. Always fatal B. Dominate C. Always homozygous D. Recessive

18 $300,000  Clint is heterozygous with SCD, so is his wife. What is the percentage their child will have SCD and/or be a carrier? A. 25% B. 50% C. 75% D. 100%

19 $400,000  A woman is a homozygous SCD carrier and her husband is not a carrier. What is not the genotypic ratio their child will have SCD? A. 1:2:1 B. 1:1 C. 2:2 D. 1

20 $500,000  Proteins: A. Are based on A, T, C, U B. Produce all genetic traits C. Responsible for half our body functions D. Dictate our life expectancy

21 $600,000  Change this DNA sequence into mRNA: AACGATACCAACGATACC A. UUGCUAUGGUUGCUAUGA B. UUCCUAUUGUUGCUAUGG C. UUGCUAUUGCUGGCUAUG D. UUGCUAUGGUUGCUAUGG

22 $800,000  What does not determine the shape of a protein? A. Amino Acids present B. Number of Amino Acids C. Order of Amino Acids D. Surrounding Environment

23  Which is not a step of protein synthesis? A. Info on DNA is copied to mRNA B. mRNA enters the nucleus C. Ribosome attaches to mRNA and tRNA brings amino acids D. Amino acids match w/ 3 at a time and ribosomes assemble amino acids into specific protein originally coded for by the gene on the DNA


Download ppt "Cassie, Abbie, Marie. $1,000  A medical career that is involved with SCD would be: A. Cardiologist B. Blood Spatter Analyst C. Hematologist D. DNA Analyst."

Similar presentations


Ads by Google