1. Today… Genome 351, 8 April 2013, Lecture 3 The information in DNA is converted to protein through an RNA intermediate (transcription) The information in the RNA intermediate is converted into protein (translation) DNA & RNA use a triplet code for amino acids A gene is a segment of DNA that specifies a protein Promoters: start sites of transcription

2. How does info in DNA flow to protein? The genetic material: DNA -Four subunits (bases A, C, G, T) But virtually all cellular functions are mediated by proteins -Twenty subunits (amino acids) How does this work? C AT G

3. The RNA Tie Club -Proposed that a transient ribonucleic acid (RNA) intermediate is involved in the conversion of info from DNA to protein

4. The “Central Dogma” DNAProtein DNA Bases include A,C,G,T DNA is double- stranded RNA 5’ 3’ sugar- phosphate backbone deoxyribose sugar in DNA ribose sugar in RNA translation RNA Bases include A,C,G,U RNA is (mostly) single-stranded (G:C & A:U) transcription ??? messenger RNA (mRNA)

5. The “Central Dogma” -Information only flows one way -It’s universal (works the same way in prokaryotes & eukaryotes) DNAmRNA Protein DNA replication (heredity) phenotype transcription translation genotype

6. Transcription: copy gene into mRNA to make a specific protein promoter mRNA promoter terminator gene 117.3117.1 116.9 116.7 GASZ CFTRCORTBP2 position in human sequence (millions of bases) where transcription begins (more later) where trans- cription ends This region from chromsome 7 contains the CFTR (cystic fibrosis gene): Mendel’s units of information (genes) are particular sequences along the chromosomes.

7. Transcription: copy gene into mRNA to make a specific protein mRNA promoter gene promoterterminator 117.3117.1 116.9 116.7 GASZ CFTRCORTBP2 position in human sequence (millions of bases) Mendel’s units of information (genes) are particular sequences along the chromosomes. where transcription begins (more later) where trans- cription ends This region from chromsome 7 contains the CFTR (cystic fibrosis gene):

8. Transcription: copy gene into mRNA to make a specific protein mRNA promoter gene 5’3’ 5’ A G C T C G 5’3’ 5’ A T C G C G RNA polymerase promoter

9. Transcription: copy gene into mRNA to make a specific protein mRNA promoter gene 5’3’ 5’ 3’ 5’ A T G A C G C C G A G C T C G promoter

10. 5’3’ 5’ T A coding or sense strand (same sequence as mRNA) template strand (complementary to mRNA) Where’s the 5’ end of the gene? of the mRNA? mRNA A U T A C C G Transcription: copy gene into mRNA to make a specific protein 5’ 3’ Which way is RNA polymerase moving?

11. Transcription: copy gene into mRNA to make a specific protein I. initiation II. elongation III. termination

12. Transcription in vivo gene nascent RNA transcripts DNA RNA polymerases Which way (right or left) are RNA polymerases moving? Where (right or left) is the promoter? Which strand (top or bottom) is the template?

13. Transcription in vivo gene nascent RNA transcripts DNA RNA polymerases Which way (right or left) are RNA polymerases moving? Where (right or left) is the promoter? Which strand (top or bottom) is the template? 5’ 3’ 5’ 3’ 5’ 3’

14. Transcription Translation RNA carries the information from DNA in the nucleus to the cytoplasm DNA RNA Protein

15. But how do 4 bases encode 20 different amino acids?

16. The Morse Code … --- …= SOS Morse code key Letters: Numbers: A lot of information can be relayed using just a 3 bit code: dots, dashes and spaces

17. Translating the nucleic acid code (4 different bases) to a protein code (20 aa’s)… Possible coding systems: 1 base per amino acid Could only code for 4 amino acids! 2 bases per amino acid Could only code for 16 amino acids 3 bases per amino acid 64 possible combinations… that’s plenty! How is information coded in DNA?

18. 20 different amino acids and 64 possible combinations of three bases (64 “codons”) Alanine Arginine Aspartic acid Aspargine Cysteine Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine Stop Ala Arg Asp Asn Cys GlT Gln Gly His Ile LeT Lys Met Phe Pro Ser Thr Trp Tyr Val ARDNCEQGHILKMFPSTWYV*ARDNCEQGHILKMFPSTWYV* GCA, GCC, GCG, GCT AGA, AGG, CGA, CGC, CGG, CGT AAC, AAT GAC, GAT TGC, TGT GAA, GAG CAA, CAG GGA, GGC, GGG, GGT CAC, CAT ATA, ATG, ATT TTA, TTG,CTA, CTC, CTG, CTT AAA, AAG ATG TTC, TTT CCA, CCC, CCG, CCT AGC, AGT, TCA, TCC, TCG, TCT ACA,ACC, ACG, ACT TGG TAC, TAT GTA, GTC, GTG, GTT TAA, TAG, TGA There is redundancy (more than one codon) for some amino acids, but each codon specifies only one amino acid

19. The Genetic Code Table 10.5

20. = stop Another type of genetic code table

21. MetPheThrValSerThr AU G A C UU U U U AA A A AA C C C CG NH 3 + COO - 5’3’ mRNA protein The triplet code 3 bases = 1 amino acid More than 1 triplet can code for the same amino acid Translation: read the information in RNA to order the amino acids in a protein codon Translation: converting the nucleic acid code to protein

22. Punctuation: MetPheThrValSerThr AU G A C UU U U U AA A A AA C C C CG NH 3 + COO - 5’3’ mRNA protein start:AUG = methionine, the first amino acid in (almost) all proteins stop:UAA, UAG, and UGA. STOP Translation: converting the nucleic acid code to protein

23. Translation of the mRNA requires an RNA adaptor called transfer RNA (tRNA) Each codon has a specific tRNA with a complementary anticodon, linked to a specific amino acid. pairs with the codon in mRNA

24. anticodon tRNAs ferry amino acids to the mRNA during translation aminoacyl-tRNA synthetase amino acid transfer RNA (tRNA) “charged” tRNA UAC Met UAC Met 3’ 5’ AUG 3’ Recognizes AUG codon in mRNA

25. A large complex of ribosomal RNAs (rRNAs) & proteins make up a ribosome Two subunits that join during protein synthesis rRNAs Provide structural support and serve as catalysts (ribozymes) The ribosome: mediates translation 1,900 base rRNA ~33 proteins 5,080 bases of rRNA (2-3 different rRNAs) ~49 proteins

26. After the 1st two tRNAs have bound… ribosome UAC Met... UGA Thr... ribosome + met-tRNA locates the 1st AUG (from 5’ end) & sets the reading frame for codon-anticodon base-pairing Translation 5’3’ mRNA …AUAUGACUUCAGUAACCAUCUAAC A…

27. ribosome UAC... UGA Thr... Translation 5’3’ Met …AUAUGACUUCAGUAACCAUCUAAC A… mRNA the ribosome breaks the Met-tRNA bond; Met is joined to the second amino acid…

28. UAC Met the ribosome breaks the Met-tRNA bond; Met is joined to the second amino acid… the Met-tRNA is released UGA Thr... …then ribosome moves over by 1 codon in the 3’ direction ribosome 5’3’ …AUAUGACUUCAGUAACCAUCUAAC A… mRNA Translation

29. Met UGA Thr... and the next tRNA can bind, and the process repeats AGU... Ser 5’3’ …AUAUGACUUCAGUAACCAUCUAAC A… mRNA Translation

30. Met UGA Thr AGU... Ser 5’3’ …AUAUGACUUCAGUAACCAUCUAAC A… mRNA Translation

31. Met Thr AGU... Ser 5’3’ …AUAUGACUUCAGUAACCAUCUAAC A… mRNA Translation

32. UAG... Met Thr Ser ValThrPhe STOP When the ribosome reaches the Stop codon… termination 5’3’ …AUAUGACUUCAGUAACCAUCUAAC A… Translation

33. Met Thr Ser ValThrPhe NH 3 + COO - The finished peptide! 5’3’ …AUAUGACUUCAGUAACCAUCUAAC A… Peptide = short protein Polypeptide = longer protein

34. Transcription and translation occur in separate compartments in eukaryotes… Transcription Translation

35. transcription and translation take place in the same compartment mRNAs covered with ribosomes DNA …but bacteria lack a nucleus

36. Where are the 5’ and 3’ ends of the mRNA? DNA mRNA ribosome Questions A B 5’3’ 5’ 3’

37. 2. Which way (to the right or to the left) are ribosomes A and B moving? 3. Toward which end (left or right) is the AUG start codon? 4. Which ribosome (A or B) has the shorter nascent polypeptide? 5. Which end of the polypeptide (amino or carboxy) has not yet been synthesized? A B 5’3’ Left Right B carboxy Questions

38. Which strand on the DNA sequence is the coding (sense) strand? How can you tell? upper strand Questions

39. On the DNA sequence, circle the nucleotides that correspond to the start codon. Questions

40. How many amino acids are encoded by this gene? 13 Questions

41. Do you expect the start and stop codons of gene 2 to be represented in the DNA sequence that is shown? Questions

42. The form of mRNA An mRNA starts out with non-coding sequence at the beginning, followed by a start codon, the coding sequence, a stop codon and more non-coding sequence The non-coding portion is often referred to as the ‘untranslated region’ or UTR. 5’3’ Non- coding Coding sequence that gets translated into protein Translation start Translation stop Next Time: How is transcription regulated?