2. AP Biology 2007-2008 From Gene to Protein How Genes Work

3. AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA

4. AP Biology The “Central Dogma” Flow of genetic information in a cell  How do we move information from DNA to proteins? protein RNA DNAtrait

5. AP Biology Beadle & Tatum 1941 | 1958 George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events" one gene : one enzyme hypothesis

6. AP Biology mRNA From gene to protein DNA nucleuscytoplasm a a a a a a a a a aa protein trait

7. AP Biology 2007-2008 Transcription from DNA language to RNA language

8. AP Biology RNA ribose sugar N-bases  ____________________ ____________________ lots of RNAs  mRNA, tRNA, rRNA, siRNA… RNADNA transcription

9. AP Biology Transcription Making mRNA  transcribed DNA strand = ___________________  enzyme __________________________ template strand rewinding mRNA RNA polymerase unwinding DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU 5 3 5 3 3 5 build RNA 5  3

10. AP Biology Initiation ________________________  binding site before beginning of gene  __________________________________  binding site for RNA polymerase

11. AP Biology Elongation Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3'

12. AP Biology Termination Eventually the RNA transcript is released and the polymerase detaches (complete mechanism still not fully known)

13. AP Biology Eukaryotic genes have junk! Eukaryotic genes are not continuous  ___________ = the real gene expressed / coding DNA  ___________ = the junk inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence

14. AP Biology mRNA splicing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Post-transcriptional processing  eukaryotic mRNA needs work after transcription  ______________________________ edit out introns  ______________________________ ~10,000 bases ~1,000 bases

15. AP Biology Splicing must be accurate No room for mistakes!  a single base added or lost throws off the _______________________ AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

16. AP Biology RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5'

17. AP Biology Alternative splicing _______________________________________  when is an intron not an intron…  different segments treated as exons

18. AP Biology A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P 50-250 A’s More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm  enzymes in cytoplasm attack mRNA protect the ends of the molecule ________________________________

19. AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa translation ribosome trait protein