Download presentation
Presentation is loading. Please wait.
Published byKenneth Bruce Modified over 8 years ago
2
AP Biology 2007-2008 From Gene to Protein How Genes Work
3
AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA
4
AP Biology The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? protein RNA DNAtrait
5
AP Biology Beadle & Tatum 1941 | 1958 George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events" one gene : one enzyme hypothesis
6
AP Biology mRNA From gene to protein DNA nucleuscytoplasm a a a a a a a a a aa protein trait
7
AP Biology 2007-2008 Transcription from DNA language to RNA language
8
AP Biology RNA ribose sugar N-bases ____________________ ____________________ lots of RNAs mRNA, tRNA, rRNA, siRNA… RNADNA transcription
9
AP Biology Transcription Making mRNA transcribed DNA strand = ___________________ enzyme __________________________ template strand rewinding mRNA RNA polymerase unwinding DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU 5 3 5 3 3 5 build RNA 5 3
10
AP Biology Initiation ________________________ binding site before beginning of gene __________________________________ binding site for RNA polymerase
11
AP Biology Elongation Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3'
12
AP Biology Termination Eventually the RNA transcript is released and the polymerase detaches (complete mechanism still not fully known)
13
AP Biology Eukaryotic genes have junk! Eukaryotic genes are not continuous ___________ = the real gene expressed / coding DNA ___________ = the junk inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence
14
AP Biology mRNA splicing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Post-transcriptional processing eukaryotic mRNA needs work after transcription ______________________________ edit out introns ______________________________ ~10,000 bases ~1,000 bases
15
AP Biology Splicing must be accurate No room for mistakes! a single base added or lost throws off the _______________________ AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|
16
AP Biology RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5'
17
AP Biology Alternative splicing _______________________________________ when is an intron not an intron… different segments treated as exons
18
AP Biology A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P 50-250 A’s More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule ________________________________
19
AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa translation ribosome trait protein
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.