1. ©C. Allen Black; SunPillar, LLC 2002 Nucline RNA SunPillar, LLC

2. ©C. Allen Black; SunPillar, LLC What is Nucline? Nucline is a full length mRNA molecule. It is conditionally translated into a protein. Protein is only expressed when researcher-defined gene profiles are present in the cell. It can be used to modify, tag, and even destroy cells that express the gene profile. It is not siRNA (methylates target DNA) or antisense (blocks mRNA translation.) These only “turn off”/”turn down” protein expression.

3. ©C. Allen Black; SunPillar, LLC mRNA translation 30s ribosome subunit binds the 5’ cap. It scans through the mRNA sequence. It stalls at the AUG start condon, binds the 50s subunit and beings translating the protein. The 5’ Untranslated Region (UTR) upstream of the start codon regulates scanning and initiation.

4. ©C. Allen Black; SunPillar, LLC mRNA can be “blocked” by 5’ UTR secondary structure The ribosome requires energy to scan through the UTR. A mRNA with strong secondary structure prevents the ribosome from ever reaching the AUG codon. The ribosome cannot melt the structure. E.g. Antisense, stem-loops, and hairpins impede the ribosome and prevent translation.

5. ©C. Allen Black; SunPillar, LLC Nucline: designing a “drug” by example Pick a disease: B cell lymphoma Pick what gene you wish the target cell to express: pertussis toxin (suicide gene) Pick sequences (normal or mutant) that are only expressed in B cell lymphoma (mutant c-myc and IgM) Insert construct into an mRNA transcription vector, runoff mRNA, and ligate repressors. Deliver mRNA via liposomes, virosomes, ballistic penetration, electroporation etc.

6. ©C. Allen Black; SunPillar, LLC Step 1: the protein Construct suicide gene. AUG placed upstream of pertussis toxin. All transfected cells will die. mRNA permanently “on.” No secondary structure.

7. ©C. Allen Black; SunPillar, LLC Step 2: the 5’UTR Place sense sequences (100bp) corresponding to c- myc and IgM in the 5’UTR. All transfected cells will die. mRNA permanently “on.” No secondary structure present.

8. ©C. Allen Black; SunPillar, LLC Step 3: Ligate antisense Add anti- sense sequences (100 bp) complementary to IgM and c-myc in the 5’UTR.

9. ©C. Allen Black; SunPillar, LLC Nucline in normal cells In IgM -, c-myc - cells, antisense stays “stuck” to Nucline. The antisense has only Nucline coded sense sequences to bind. No translation in normal cells.

10. ©C. Allen Black; SunPillar, LLC Nucline in normal B cells. Anti-sense will hybridize to its complements. In normal B cells (non-c-myc cells), IgM wt mRNA competes off the antisense. The antisense “choses” between binding Nucline or wt IgM RNA. Both have sense sequences so competitive hybridization occurs. The c-myc antisense stays “stuck” to Nucline. Still, no translation. Half of secondary structure still present.

11. ©C. Allen Black; SunPillar, LLC Nucline in B cell lymphoma. Anti-sense will hybridize to its complements. IgM wt mRNA competes off the IgM antisense. c-myc wt RNA competes off the c-myc antisense. TRANSLATION. All of secondary structure removed.

12. ©C. Allen Black; SunPillar, LLC But this is biology, will it really work?

13. Detecting Estrogen Receptor Overexpression Using the plasmid provided the GFP along with the ER regions was amplified using the two primers Nucln FP and Nucln RP. RNA was synthesized using this PCR DNA and Ribomax kit from Promega. MCF-7 cells were purchased from ATCC and were grown in RPMI medium with 10% fetal calf serum. For transfection 1 ug RNA was mixed 1ug of Nucline and boiled for 10 min and allowed to hybridize. To this 2 ul of Tfx-50 reagent (Promega) was added and incubated for 10 min with 300 ul serum free medium. This was added to MCF-7 cells, after washing the monolayer with RPMI without serum. The cell density was about 60 to 70%. Transfection was allowed for 30 min after which the medium was removed and replaced by serum containing medium. The cells were observed under microscope after 24 hrs post-transfection ER Target Sequence: 5’ ggtcacgtggtaactatttggtcacgtggtaactattt Special Thanks to Dr. Augustine Rajakumar (University of Pittsburgh) and Dr. Yunus Luqmani (Kuwait University) for providing these Estrogen Receptor data. ©C. Allen Black; SunPillar, LLC

14. MCF-7 Cells (Bright Field) ©C. Allen Black; SunPillar, LLC

15. MCF-7 Positive Control GFP Plasmid ©C. Allen Black; SunPillar, LLC

16. Nucline Transfection Specific for Estrogen Receptor Overexpression ©C. Allen Black; SunPillar, LLC

17. Repeated Again ©C. Allen Black; SunPillar, LLC

18. What about in vivo? Mouse solid tumor model (MM2MT breast carcinoma). DeFatta, RJ, Li, Y., De Bendetti, Cancer Gene Therapy 9:503 (2002). Introduced RNA with impenetrable 5’ UTR (hairpins). RNA coded suicide gene. DNA coding the RNA was lipofected into animals. eIF4E (cap binding protein) over expressed in tumor, not regular cells. It “melts” RNA structure in cancer but not normal cells. 120 day survival: 0/10 control; 7/10 experimental. 70% cure rate.

19. ©C. Allen Black; SunPillar, LLC Curing Cancer (in mice) DeFatta et al. used “protein assisted” melting. Nucline uses “sequence assisted” competitive hybridization to melt secondary structure. Nucline is sequence specific, eIF4E melts any secondary structure. Mode of melting irrelevant for biological effect RNA with de-repressible secondary structure (confering specificity) cures cancer in mice. Nucline design increases the utility and specificity.

20. ©C. Allen Black; SunPillar, LLC Uses FACS (deliver fluorescent protein) (+)/(-) cell selection (suicide/proliferation inducing genes) Disease models (suicide genes, repair genes) Wound repair/gene defects (deliver proliferation inducing genes or new “correct” gene) Detect mRNA/(s)tructural RNA profiles, mRNA/sRNA concentration, mRNA/sRNA sequences.

21. ©C. Allen Black; SunPillar, LLC Nucline Logic It is a logic system where A,B are cellular mRNA sequences and Y is a protein to be expressed in those cells alone. IF A is present, THEN release Y. (One antisense blocking translation) IF A and B are present, THEN release Y. (different antisense targets on same Nucline RNA, e.g. lymphoma Nucline) IF A or B is present, THEN release Y. (Combine two different kinds of Nucline molecules) IF A is present > 100 copies, THEN release Y. (Nucline with 101 redundant antisense stuck to it) IF A but not B present, THEN release Y. (advancing) IF A present < 100 copies, THEN release Y. (advancing)

22. ©C. Allen Black; SunPillar, LLC WWW.SUNPILLAR.COM allenblack@sunpillar.com