1. Transcription and Translation

2. If DNA never leaves the nucleus, how can the DNA message get to the site of protein production, the ribosome?

3. Answer: The DNA message is copied to RNA during the process of Transcription Transcription

4. How do RNA and DNA differ?

5. D. The Structure of RNA 1.RNA is single stranded 2.The sugar in RNA is Ribose, not deoxyribose as in DNA 3.The DNA nucleotide thymine is replaced by the RNA nucleotide Uracil

6. E. RNA’s Functions: Two Types, Two Jobs 1.m-RNA (messenger RNA) delivers the copied DNA from the nucleus to the Ribosome- the site of protein synthesis 2.t-RNA (transfer RNA) picks up specific amino acids in the cytoplasm and delivers them to the ribosome

7. Ribosome

8. F. Steps in Protein SynthesisSteps in Protein Synthesis 1.DNA molecule unzip where the desired gene is located 2.Free floating RNA nucleotides pair with the DNA strand forming m-RNA (Transcription) 3.The m-RNA leaves the nucleus and goes to a ribosome 4.A specific t-RNA delivers a specific amino acid to the ribosome (Translation) 5.The m-RNA codon matches with the t-RNA anticodon bringing the amino acid into its proper place 6.When the next amino acid is in place, the two are joined in a condensation reaction 7.The process is repeated until a stop code is read and a complete protein is formed

9. DNA STRAND: TACAGTGGCCTAGATCATATT

10. G. Mutation- change in the genetic code 1. Gene Mutation or Point Mutation- a nucleotide base is added, subtracted or changed to produce a change in the amino acid sequence of a protein

11. A change in a single base in the DNA strand will result in a change in the m-RNA strand and the resulting protein Normal Hemoglobin DNA GGA CTC CTC RNA CCU GAG GAG Amino Acids Proline Glutamic Acid Glutamic Acid Sickle Cell Hemoglobin 5 6 7 GGA CAC CTCCCU GUG GAG Proline Valine Glutamic Acid

14. 2. Chromosome Mutation- involves a change in many genes a) Deletion- part of a chromosome is lost b) Inversion- part of a chromosome is flipped around c) Translocation- part of a chromosome is added to another chromosome

15. 3. Somatic & Germ Mutations a) Somatic mutations: change that occurs in body cells. Affects only the individual. Ie. cancer b) Germ Mutations- changed in the genetic code of gametes that will affect the individuals offspring 4. Mutagens- substances capable of causing damage to DNA 5. Most mutations are harmful

16. 6. Frame Shift Mutations A)An insertion or deletion that results in the reading frame being shifted. B)All codons following the mutation will be changed. C)Example: THE RED DOG ATE THE CAT HER EDD OGA TET HEC AT