1. Transcription and Translation

2.  Genes: are segments of DNA that code for proteins  Most nucleotide base sequences in DNA don’t code for anything  ATGCGAATCGTAGCATACGATGCATGCACGTG CATGCTTTTAGCAGCATGCAGCATGCAGCTAT ACGATAGCTAGCTAGCTCGATGCATGCATCGA TGCTAGCATGCTAGCTAGCATGCATGCATGCA CGTTATCGTTAAATTTTTCTTGGGTTAATTGGG

3.  Is the process that opens up a gene coding portion of DNA and makes a copy (transcript) of the base sequences to go on and make a protein  Transcription can be broken down into 3 simple steps

4.  The process of transcription begins as the enzymes (helicase) unzip the DNA in the region of the gene that will be copied (transcribed)

5.  RNA Polymerase binds to the DNA and begins forming base pairs with the complementary bases of DNA  The transcript of DNA it makes is called mRNA

6.  Is a segment of copied DNA that codes for a protein  mRNA has 3 differences with DNA ◦ 1. mRNA’s sugar is ribose ◦ 2. mRNA’s is single stranded ◦ 3. mRNA doesn’t have thymine (T) as a base pair, instead is has Uracil ◦ SO… G still binds to C ◦ But.. A binds to U in mRNA

7.  So RNA polymerase matches the correct bases from the DNA, let’s practice RNA polymerase’s job  IF DNA had this nucleotide sequence, what sequence will the mRNA have?  ATTGCCTTGGAATCCGTCA---DNA  UAACGGAACCUUAGGCACU---mRNA

8.  The mRNA stand breaks away from the DNA and leaves the nucleus of the cell and enters the cytoplasm  The DNA strands rejoin each other

9.  Transcription makes a copy of nucleotide bases from DNA that serve as a code for making proteins ◦ So the code is written in a sequence of bases  Proteins are long chains of Amino Acids ◦ So the code of a protein is the sequence of aminoacids  Translation from bases to amino acids is the next step to building a protein

10.  How does the mRNA base sequence code for the 20 common amino acids it needs to build a protein?  Each set of 3 bases in a row codes for differing amino acids, a set of 3 is called a codon ◦ Each codon codes for differing amino acids

11.  All sequences start with AUG

12.  Recall that ribosomes are found in both the nucleus and cytoplasm, and they are responsible for making protiens  mRNA that has been transcribed is moved out of the nucleus to the cytoplasm where a ribosome will bind to it and begin making a protein from the mRNA code

13.  Can be broken down into 5 simples steps

14.  Ribosome attaches to the mRNA strand in the cytoplasm  Molecules of tRNA, each carrying a specific amino acid, approach

15.  Is a specialize strand of RNA that binds to a specific amino acid and also has a anticodon region that complements a mRNA strand to attach the correct amino acid to make a protein  So if the mRNA has the codon GCU the anticodon in tRNA will be CGA

16.  The start Codon AUG, which codes for the amino acid methionine, is found on the mRNA strand  A tRNA carrying methionine attaches to the ribosome and mRNA strand

17.  A tRNA molecule matching the next codon in the mRNA comes in and binds to the ribosome and mRNA  The methionine and the new amino acid just brought in attach to each other via a peptide bond

18.  After the peptide bond is formed, the ribosome slides along the mRNA strand to the next codon  The first tRNA is released (no longer carrying the amio acid methionine)  A new tRNA comes in a brings the correct amino acid

19.  The process continues to repeat, forming a chain of amino acids, until a stop codon is reached  Then the ribosome releases the new protein, which can now fold and become functional