Download presentation
Presentation is loading. Please wait.
Published byAudrey Gallagher Modified over 9 years ago
1
DNA and Protein Synthesis
2
Protein Synthesis It’s a process –DNA -> RNA -> Amino Acids (Protein)
3
RNA Sugar is Ribose NOT what… Has nitrogen base Uracil instead of Thymine –Also contains the other 3 bases…what are they? Only single stranded
4
RNA
5
Three processes in this unit… 1. Replication (DNA DNA) 2. Transcription (DNA mRNA) 3. Translation (RNA Protein)
6
A. DNA Replication 1.Occurs in the nucleus prior to any cell division 2.Enzyme is used to “unzip” or “unwind” the DNA a.Forms a bubble at the origin site
7
DNA Replication (cont.) 3.Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA a.Nitrogenous bases pair up 1.A – T 2.C - G 4.As a result, you create two identical strands of DNA
8
Let’s Practice Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG
9
Let’s Build A Protein
10
Transcription 1.) DNA strand unzips –The bonds between the nitrogen bases are broken –Initiated by RNA polymerase (enzyme) binding to promoter site on DNA 2.) A single strand of mRNA (messenger RNA) is made –Pair up the bases A T C G The mRNA then travels from nucleus to cytoplasm
11
Transcription
12
Where in the cell does transcription take place? 1.Cytoplasm 2.Mitochondria 3.Nucleus 4.Golgi Body 5.Vacuole
13
Any given segment of DNA has directions that make unique what? 1.Glucose 2.Proteins 3.Lipids 4.Blood cells
14
If a DNA strand has the following sequence of base pairs – A C T G G T C C A A, then the mRNA strand would have what sequence? 1.T G A C C A G G T T 2.A C T G G T C C A A 3.T G U C C U G G T T 4.U G A C C A G G U U
15
Why is mRNA called messenger RNA? Because it carries the directions to make a protein to the ribosome like a message
16
Actually 3 types of RNA mRNA- messenger –Brings message from nucleus to ribosomes in cytoplasm rRNA- ribosomal –Make up a ribosome tRNA- transfer –“transfers” amino acids from the cytoplasm to the ribosome to be added to the chain
17
The difference between RNA and DNA is what? 1.The phosphates 2.The sugars 3.The nitrogen bases 4.The way the monomer units bond
18
mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? 1.Mitochondria 2.Ribosome 3.Golgi Body 4.Lysosome 5.Nucleus
19
Translation 1. mRNA meets up with a ribosome…why?? –Ribosomes are the site for protein production 2. tRNA molecules bring amino acids to ribosomes 3. An mRNA codon will pair with a tRNA anticodon –Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid –Anticodon: 3 Nitrogen base sequence in tRNA
20
Translation (cont.) 4.As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.
21
That’s the process, Now how do you know what amino acids make up a particular protein We use an mRNA codon chart
22
Where in the cell does transcription, the first part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Ribosomes 4.Cytoplasm 1234567891011121314151617181920 2122232425262728
23
DNA has the directions to make what? 1.Glucose 2.Nucleotides 3.Proteins 4.Monosaccharides 1234567891011121314151617181920 2122232425262728
24
After a strand of mRNA is made where does it go? 1.Ribosome 2.Mitochondria 3.Lysosome 4.Vacuole 1234567891011121314151617181920 2122232425262728
25
Where in the cell does translation, the second part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Golgi body 4.Cytoplasm 1234567891011121314151617181920 2122232425262728
26
Molecules called tRNA’s are floating around the cytoplasm carrying what? 1.mRNA’s 2.Glucose 3.DNA 4.Nucleotides 5.Amino Acids 1234567891011121314151617181920 2122232425262728
27
An mRNA codon is made up of how many nitrogen bases? 1.1 2.3 3.6 4.24 1234567891011121314151617181920 2122232425262728
28
Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? 1.Phenylalanine 2.Glutamine 3.Asparagine 4.Lysine 5.Tyrosine 1234567891011121314151617181920 2122232425262728
29
What protein would be synthesized from the following mRNA strand? A C U U U C G A A U A C 1.Threonine – phenylalanine – glutamate – tyrosine 2.Phenylalanine – leucine – methionine – valine 3.Tyrosine – glutamate – phenylalanine – threonine 4.Lysine – cysteine – arginine – histidine 1234567891011121314151617181920 2122232425262728
30
What protein would be synthesized from the following DNA segment? T A A G T A C G C T A G 1.Isoleucine – alanine – histidine – alanine 2.Isoleucine – histidine – alanine – isoleucine 3.Phenylalanine – leucine – valine – arginine 4.Isoleucine – leucine – threonine – lysine 1234567891011121314151617181920 2122232425262728
31
How would you assess your comprehension of DNA and Protein Synthesis? 1.A 2.B 3.C 4.D 1234567891011121314151617181920 2122232425262728
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.