1. DNA and Protein Synthesis

2. Protein Synthesis It’s a process –DNA -> RNA -> Amino Acids (Protein)

3. RNA Sugar is Ribose NOT what… Has nitrogen base Uracil instead of Thymine –Also contains the other 3 bases…what are they? Only single stranded

4. RNA

5. Three processes in this unit… 1. Replication (DNA  DNA) 2. Transcription (DNA  mRNA) 3. Translation (RNA  Protein)

6. A. DNA Replication 1.Occurs in the nucleus prior to any cell division 2.Enzyme is used to “unzip” or “unwind” the DNA a.Forms a bubble at the origin site

7. DNA Replication (cont.) 3.Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA a.Nitrogenous bases pair up 1.A – T 2.C - G 4.As a result, you create two identical strands of DNA

8. Let’s Practice Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG

9. Let’s Build A Protein

10. Transcription 1.) DNA strand unzips –The bonds between the nitrogen bases are broken –Initiated by RNA polymerase (enzyme) binding to promoter site on DNA 2.) A single strand of mRNA (messenger RNA) is made –Pair up the bases A  T  C  G  The mRNA then travels from nucleus to cytoplasm

11. Transcription

12. Where in the cell does transcription take place? 1.Cytoplasm 2.Mitochondria 3.Nucleus 4.Golgi Body 5.Vacuole

13. Any given segment of DNA has directions that make unique what? 1.Glucose 2.Proteins 3.Lipids 4.Blood cells

14. If a DNA strand has the following sequence of base pairs – A C T G G T C C A A, then the mRNA strand would have what sequence? 1.T G A C C A G G T T 2.A C T G G T C C A A 3.T G U C C U G G T T 4.U G A C C A G G U U

15. Why is mRNA called messenger RNA? Because it carries the directions to make a protein to the ribosome like a message

16. Actually 3 types of RNA mRNA- messenger –Brings message from nucleus to ribosomes in cytoplasm rRNA- ribosomal –Make up a ribosome tRNA- transfer –“transfers” amino acids from the cytoplasm to the ribosome to be added to the chain

17. The difference between RNA and DNA is what? 1.The phosphates 2.The sugars 3.The nitrogen bases 4.The way the monomer units bond

18. mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? 1.Mitochondria 2.Ribosome 3.Golgi Body 4.Lysosome 5.Nucleus

19. Translation 1. mRNA meets up with a ribosome…why?? –Ribosomes are the site for protein production 2. tRNA molecules bring amino acids to ribosomes 3. An mRNA codon will pair with a tRNA anticodon –Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid –Anticodon: 3 Nitrogen base sequence in tRNA

20. Translation (cont.) 4.As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.

21. That’s the process, Now how do you know what amino acids make up a particular protein We use an mRNA codon chart

22. Where in the cell does transcription, the first part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Ribosomes 4.Cytoplasm 1234567891011121314151617181920 2122232425262728

23. DNA has the directions to make what? 1.Glucose 2.Nucleotides 3.Proteins 4.Monosaccharides 1234567891011121314151617181920 2122232425262728

24. After a strand of mRNA is made where does it go? 1.Ribosome 2.Mitochondria 3.Lysosome 4.Vacuole 1234567891011121314151617181920 2122232425262728

25. Where in the cell does translation, the second part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Golgi body 4.Cytoplasm 1234567891011121314151617181920 2122232425262728

26. Molecules called tRNA’s are floating around the cytoplasm carrying what? 1.mRNA’s 2.Glucose 3.DNA 4.Nucleotides 5.Amino Acids 1234567891011121314151617181920 2122232425262728

27. An mRNA codon is made up of how many nitrogen bases? 1.1 2.3 3.6 4.24 1234567891011121314151617181920 2122232425262728

28. Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? 1.Phenylalanine 2.Glutamine 3.Asparagine 4.Lysine 5.Tyrosine 1234567891011121314151617181920 2122232425262728

29. What protein would be synthesized from the following mRNA strand? A C U U U C G A A U A C 1.Threonine – phenylalanine – glutamate – tyrosine 2.Phenylalanine – leucine – methionine – valine 3.Tyrosine – glutamate – phenylalanine – threonine 4.Lysine – cysteine – arginine – histidine 1234567891011121314151617181920 2122232425262728

30. What protein would be synthesized from the following DNA segment? T A A G T A C G C T A G 1.Isoleucine – alanine – histidine – alanine 2.Isoleucine – histidine – alanine – isoleucine 3.Phenylalanine – leucine – valine – arginine 4.Isoleucine – leucine – threonine – lysine 1234567891011121314151617181920 2122232425262728

31. How would you assess your comprehension of DNA and Protein Synthesis? 1.A 2.B 3.C 4.D 1234567891011121314151617181920 2122232425262728