Presentation is loading. Please wait.

Presentation is loading. Please wait.

Folding-based Electrochemical Biosensors

Similar presentations


Presentation on theme: "Folding-based Electrochemical Biosensors"— Presentation transcript:

1 Folding-based Electrochemical Biosensors
Rebecca Y. Lai Department of Chemistry University of Nebraska-Lincoln

2 “Traditional” Biosensor
Specific Binding Biosensor Signal Measure changes in adsorbed mass, polarizability, sterics or charge

3 Folding-based Biosensors: Signal Transduction Mechanism
Specific Binding Biosensor Non - specific Binding Signal Signaling linked to a binding-specific change in the physical properties of the biopolymer

4 Electrochemical Biosensors
Low background, fewer electrochemically active contaminants in biological systems Low mass, volume, power Low cost, mass production Parallelization, adaptable to arraying strategies Example: glucose meter

5 Microfabricated gold electrode array
Materials and Methods Biosensor Interrogation Method: Alternating Current Voltammetry Counter electrode Ref electrode Working electrode Length: 1 mm Width: 0.88 mm Area : mm2 Microfabricated gold electrode array 2 mm diameter Area : 3.14 mm 2 Gold disk electrodes

6 Electrochemical DNA Sensor (E-DNA)
Gold Electrode + target sequence Denaturation / Re-annealing MB *Not to scale 5’-HS-(CH2)6- GCAGTAACAAGAATAAAACGCCACTGC -(CH2)7-NH-3’-MB

7 Methylene blue Leucomethylene blue
E-DNA Sensor AC Voltammograms Reagentless (direct detection of aqueous DNA) Sensitive (pM detection limit) Rapid detection Reusable Selective Specific Methylene blue Leucomethylene blue + 2e- + H+

8 Reusable and Reproducible
E-DNA Sensor Reusable and Reproducible Selective

9 E-DNA Sensor in a Microfluidic Chamber
***In-situ sensor fabrication, hybridization and regeneration Sensor Device Sensor Response

10 Aptamers Aptamers are DNA or RNA molecules selected for their ability to fold into well-defined, three-dimensional structures and bind to specific molecular targets (e.g. proteins, small molecules) with high affinity.

11 Electrochemical Aptamer-Based (E-AB) Sensor: PDGF Detection
+ PDGF-BB Sluggish Electron Transfer Efficient Electron Transfer MB Reagentless Reusable Rapid Specific Selective Parallelizable Signal-on sensor *Not to scale 5’-HS-(CH2)6- CAGGCTACGGCACGTAGAGCATCA CCATGATCCTG-(CH2)7-NH-3’-MB

12 Sensor Response to PDGF-BB
In 50% Blood Serum Physiological concentration of PDGF in human serum = 400 pM (normal) – 700 pM (cancerous) Detection Limit: 50 pM (the mass ratio of PDGF-BB to serum protein is ~ 1 : 25 Million)

13 Peptide or Protein-base Electrochemical Biosensors
Ligand-induced Folding (LIF) Ligand-induced folding occurs when a favorable binding free energy overcomes an unfavorable folding free energy, producing a folded complex.

14 Electronic Peptide-based Sensor (E-PB Sensor)
et + target - target MB * Not to scale Peptide Probes Naturally occurring peptide capable of LIF Engineered peptide capable of LIF

15 E-PB Sensor: HIV Detection
Protein of Interest Surface Glycoprotein gp120 Transmembrane Glycoprotein gp41 Matrix Protein p17 Capsid Protein p24 15

16 E-PB Sensor: HIV Detection
Proteins of Interest Surface Glycoprotein gp120 Transmembrance Glycoprotein gp41 Matrix Protein p17 Capsid Protein p24 p17 p24 gp41 gp120 % of patients for antigen 62 58 18 38 % of patients positive for antibody 60 92 100 34

17 Detection of Anti p24 Antibodies
Probe Target Anti-p124 antibody (IgG) (~150 kDa) Response in earliest stages of AIDS Anti-p24 concentration in serum may be tens to hundreds of nanomolar HIV-1 p24 capsid protein Highly antigenic epitope sequence EAAWDRVHP

18 Sensor Response to Anti-p24 Antibodies
+ Ab - Ab Probe Sequence: HS-C11-EAAWDRVHP-K-MB

19 Future Direction of E-PB Sensor Research (Immediate!)
New immobilization methods to increase surface coverage Improve Sensor Sensitivity and Dynamic Range Improve Sensor Specificity Test sensor / self-assembled monolayer (SAM) using surface plasmon resonance (SPR) Change / modify epitope if necessary New immobilization methods Incorporate thiolated polyethylene-glycol (PEG) Improve Sensor Selectivity

20 Future Direction of E-PB Sensor Research
Click Chemistry Azide terminated alkanethiol + alkyne modified peptide w/ MB * Not to scale N3 OH + alkyne-peptide-MB + Cu(I) Advantages: Flexibility in SAM choices Step by step characterization by electrochemical methods and SPR Site-specific modification/sensor fabrication

21 Future Direction of E-PB Sensor Research
System of Interest: HIV Detection (p24, p17, gp41, gp120) Biosensor Array: Mixed-platform Detection E-PB Sensor E-AB Sensor E-DNA Sensor Hybrid E-PB Sensor

22 Peptide nucleic acid (PNA) stem + Peptide loop
Hybrid E-PB Sensor et + Ab - Ab MB * Not to scale Peptide Loop PNA Stem Peptide nucleic acid (PNA) stem + Peptide loop p24 Probe Sequence: HS-C11-GAT-EAAWDRVHP-ATC-MB

23 Future Directions in Device Fabrication
Microfabricated Devices Too Pricy and Time Consuming! gold-plated carbon electrode 2 mm diameter Area : 3.14 mm 2 Disposable Sensor Strip Handheld Potentiostat

24 E-DNA Sensor on a Gold-plated Screen-printed Carbon Electrode
2 mm diameter Area : 3.14 mm 2 Sensor Device Gold-plated Carbon Electrode Before Regenerated Hybridization Buffer 100%Serum

25 Future Directions in Sensor Strip Fabrication
Disposable Sensor Strip: Pros: cost effective, amenable to mass production Cons: larger volume requirement (50 µL in-situ, 10 µL ex-situ) Future Work: E-PB Sensor for HIV detection Volume reduction New electrode (array) design Enhance sensor stability (6 months+ shelf life) Single use electrode (gold-plated carbon electrode ) 2 mm diameter Area : 3.14 mm 2

26 THANKS! Acknowledgement University of Nebraska-Lincoln
Jennifer Gerasimov Dr. Weiwei Yang Socrates Canete Andy Springer UC Santa Barbara THANKS!


Download ppt "Folding-based Electrochemical Biosensors"

Similar presentations


Ads by Google