Presentation is loading. Please wait.

Presentation is loading. Please wait.

Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine.

Similar presentations


Presentation on theme: "Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine."— Presentation transcript:

1 Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine ATGCCTAAGTACCGTA

2 Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine Shaped like a twisted ladder –Double Helix Career Spotlight! Molecular Geneticists study the structure of DNA involved in different diseases

3 Salk Institute Mobile Lab What does DNA do? Your DNA determines your PHENOTYPE –Instruction book for your cells My DNA Each instruction is called a GENE Genes are the recipes for Proteins All your genes together is called your GENOME How your cells read your Genome depends in part on your (and your cells’) environment

4 Salk Institute Mobile Lab Reading DNA PORFAVORNOHABLECUANDO ESTOYHABLANDO. ATACGGGCTAGCCTGACGTCA GTTTAAAAGCCCTG.

5 Salk Institute Mobile Lab TGACGTAAAGCTTGACCTAPUT A HAT ON YOUR HEAD PUT A BAT ON YOUR HEADTGACATAAAGCTTGACCTAPUT A BAT ON YOUR HEAD MUTATION! Reading DNA MUTATIONS are changes in your GENES that may be inherited –Even small changes in DNA can have big effects –Human DNA is ALL >99% identical! Career Spotlight! Genetic Counselors help people figure out if they might pass a disease mutation to their future children

6 Salk Institute Mobile Lab Where is DNA? DNA is found in the cells of every living organism –There are different types of cells Animal cells Plant cells Bacteria cells } DNA found in nucleus (Eukaryotic) - DNA floating loose (Prokaryotic)

7 Salk Institute Mobile Lab What color is DNA?


Download ppt "Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine."

Similar presentations


Ads by Google