1. What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer Mono, di, tri, tetra nucleotide repeats HNPCC - Expansion/contraction of nl repeats

3. Strand Slippage D2S123 TAGGCCACACACACACACACA Unique Primer 14 bp 12 bp TAGGCCACACACACACACACA 13-15 BP4-40 RPTS

4. Mis-Match Repair Genes hMSH2 hMLH1 PMS1 PMS2 hMSH3 hMSH6

5. Click for larger picture

7. Risk of CRC in Clinical HNPCC Families: Netherlands Age 44 69 Locationpr: 53%pr: 32% ds: 41%ds: 68% CI 35 10%.07% CI 50 24%.5% CI 75 42% 5.3% HNPCC Voskuil, Int J CA 1997;72:205 Sporadic

8. Risk of CRC in MSH2/MLH1 HNPCC Families: Netherlands CRC Lifetime80 Women83 Men92 Endometrial50 % Vasen, Gastro 1996;110:1020

9. HNPCC ~ 90% of tumors show MI Germline defect in MMR genes 2nd Hit - Somatic Mutation

10. MSI in Sporadic CRC 10 - 15% of sporadic CRC In HNPCC: Germline + somatic = MSI Sporadic - biallelic somatic mutation via methylation of MLH1 promoter

11. TC = Transcription Complex Click for larger picture

12. Gene Testing for hMLH1 or hMSH2 DGGE SSCP IVSP Direct Sequencing

13. Gene Testing Sensitivity Cost ($) Sequencing >90% 800 - 3,000 CSGE & Sequencing >90% 1500 Screening (SSCP) 95 - 100% 800 Screening (PTT) 50 - 60% 750 MSI NA 300 Gastro 2001;121:195

14. Gene Testing for MSH2/MLH1 509 Finnish CRC pts 63 MSI 10 (2%) MMR mutations  5/10 Founder mutation  7/10 Amsterdam Criteria  All either young, had fam hx, or previous CA Aaltonen, NEJM 1998;38:1481

15. Predictive Model for MMR Gene Testing 184 Kindreds: 26% w/ MMR mutations 1) Mean age at diagnosis of affecteds 2) At least 1 member w/ Endometrial CA 3) Amsterdam Criteria Wijnen, NEJM 1998;339:511

16. Predictive Model for MMR Gene Testing Wijnen, NEJM 1998;339:511 Logistic Model Prob <20% Prob >20% MSI + - Nothing MMR Analysis MMR Analysis

19. Bethesda Criteria and MMR Mutation + BC - BC N58 (46%)67 (54%) 125 MSI17 (29%) 5 (7.5%) 22 (18%) MMR Mutation11 (65%) 0 (0%) 11 (9%) B1 - B446 (79%) N=125, “high risk”, Frankfurt, GE Total Raedle, Ann Int Med 2001;135:566

20. Bethesda vs. Amsterdam Sens Amsterdam 6/6 27 94 Amsterdam II 8/10 46 90 Bethesda 11/17 77 60 Spec Raedle, Ann Int Med 2001;135:566 MMR Mutation MSI status Criteria to predict MSI

21. Cost Effectiveness of MSI Decision tree using MSI (Bethesda guidelines) and MMR mutations 90% CI for cost-effectiveness of screening patients with cancer & relatives: $4,874 - 21,576 / life year gained Sensitivity analysis - prevalence HNPCC mutation #1 factor Ramsey, Ann Int Med 2001;135:577

22. Click for larger picture

23. Mutations in HNPCC Kindreds 32 Kindreds (N=38) in Buffalo and Vermont Amsterdam Criteria Weber, Cancer Res 1997;57:3798 Incidence of Mutations MSH2/MLH1: 25% Conclusion: Molecular basis unknown for many subjects

24. Effectiveness of Screening in HNPCC 252 subjects, 22 Families (119 Control, 133 screen) Colon q3yrs, 1984, 15 yr F/U Not randomized - declined participation Jarvinen, Gastro 2000;118 Screen CRC8 (6%) 19 (16%).4.01 Mutation + 18% 41%.4.02 Deaths to CRC 0 8%<.001 ControlORP

25. Click for larger picture

26. Risk of Metachronous CRC

27. Colonoscopy in High Risk Individuals 31 HNPCC Families - 232 Individuals 86 (38.6%) underwent colonos-compared to controls Ponz de Leon, CEBP 1998;7:639 Case Control P CA 5 1 Adenomas 29 11.03 TV/V (#) 11 1 Ad Diam 9.15.8.02 HGD (#) 9 3

28. Center for Families at Risk for CRC Goal: To develop a registry of high risk families To assemble blood/DNA for research Recruitment: Physician referral, Media, UPCI CA Registry High Risk Definition: Young onset, FDR young onset, Multiple cancers Overall: 83 individuals (76 families) Jan ‘98 - June ‘00

29. UPCI Registry Young onset cancers - <45, 45-55 188 10682 26 11 (5.9%) 23 33 Alive Dead Agreed Not Interested Enrolled Unavailable

30. High Risk Patients 67.1% High Risk 23 Young Onset (<55) 9 Multiple CA’s 15 Young and Multiple (8 Amsterdam Criteria) 70 Probands - Complete data, exclude FAP

31. Problems With Center Lab Support Integrated Recruitment Coordinated Approach With Other Cancers

32. Gene Testing www.genetests.org www.nsgc.org