1. Analysis of C282Y mutation in hemochromatosis gene

2. PCR – mutation C282Y (hemochromatosis)
MIX – per 1 sample
15,8 ul H2O
2,5 ul buffer
1,5 ul primer 1 (P1)
1,5 ul primer 2 (P2)
2,0 ul MgCl2
0,5 ul dNTP
1,0 ul DNA
0,2 ul Taq polymerasis (add on ice)

3. PCR – mutation C282Y - ELFO

4. RFLP –Restriction Fragment Length Polymorphism
restriction analysis of DNA
by its digestion with restriction endonucleases (RE) in specific restriction sites
in the case the sequence difference (polymorphism) creates or disturbs a specific site for RE, after restriction, fragments with different sizes are formed

5. RFLP –Restriction Fragment Length Polymorphism
restriction analysis of DNA
by its digestion with restriction endonucleases (RE) in specific restriction sites
in the case the sequence difference (polymorphism) creates or disturbs a specific site for RE, after restriction, fragments with different sizes are formed

6. RFLP –Restriction Fragment Length Polymorphism
Restriction endonucleases (RE)
known about 2100 bacterial RE
RE recognize variously short nucleotides sequences (4,6,8), in which then they digest covalent phosphodiester bonds
Principle of the analysis
starting DNA (genomic DNA, PCR product)
digestion with a restriction enzyme into fragments with different sizes
fragments electrophoresis separation

7. Sequence of C282Y mutation (hemochromatosis)
5´- TGGCAAGGGTAAACAGATCCctctcctcatccttcctctttcctgtcaagtgccctcctttggtgaaggtgacacatcatgtgacctcttca
gtgaccacactacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagccaatggatgccaaggagttcgaac
ctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctGTACcccctggggaagagcagagatatacGTGCcaggtgg
agcacccaggcctggatcagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggGGTTGAGAGGAGTGC
CTGAGgaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttagagccctca
ccgtctggcaccctagtcattggagtcatcagtgga – 3´
Primers restriction endonucleasis RsaI restriction site (GTAC)
mutation C282Y (GTGC → GTAC)

8. RFLP – mutation C282Y (hemochromatosis)
MIX – per 1 sample
7,0 ul H2O
2,0 ul buffer
10 ul PCR product
1,0 restriction endonukleasis RsaI (add on ice)
Incubation 37°C 2 h

10. RFLP – mutation C282Y - ELFO

11. Hemochromatosis autosomal recessive disease affecting iron metabolism
excessive iron absorption, its deposition in organs (mainly parenchymal) and subsequent damage of the organism
hepatopathy (cirrhosis, hepatocellular carcinoma)
diabetes mellitus, arthropathy, hypogonadism, kardiomyopathy, amenorhea
serum iron, transferrin saturation, ferritin, liver biopsy
repeated phlebotomy

12. HFE gene mutations