1. Transcription Chapter 8

2. The Problem Information must be transcribed from DNA in order function further. Information must be transcribed from DNA in order function further. REMEMBER: REMEMBER: DNA  RNA  Protein DNA  RNA  Protein

3. Tanscription in Prokaryotes Polymerization catalyzed by RNA polymerase Polymerization catalyzed by RNA polymerase Can initiate synthesis Can initiate synthesis Uses rNTPs Uses rNTPs Requires a template Requires a template Unwinds and rewinds DNA Unwinds and rewinds DNA 4 stages 4 stages Recognition and binding Recognition and binding Initiation Initiation Elongation Elongation Termination and release Termination and release

4. RNA Polymerase 5 subunits, 449 kd (~1/2 size of DNA pol III) 5 subunits, 449 kd (~1/2 size of DNA pol III) Core enzyme Core enzyme 2  subunits---hold enzyme together 2  subunits---hold enzyme together  --- links nucleotides together  --- links nucleotides together  ’---binds templates  ’---binds templates  ---recognition  ---recognition Holoenzyme= Core + sigma Holoenzyme= Core + sigma

5. RNA Polymerase Features Starts at a promoter sequence, ends at termination signal Starts at a promoter sequence, ends at termination signal Proceeds in 5’ to 3’ direction Proceeds in 5’ to 3’ direction Template is copied in the 3’ – 5’ direction Template is copied in the 3’ – 5’ direction Forms a temporary DNA:RNA hybrid Forms a temporary DNA:RNA hybrid Has complete processivity Has complete processivity

6. Facts to remember DNA-dependent RNA synthesis: 1. starts at a promoter sequence, ends at termination signal 2. the first 5’-triphosphate is NOT cleaved 3. proceeds in 5’ to 3’ direction 4. new residues are added to the 3’ OH 5. the template is copied in the 3’ – 5’ direction 6. forms a temporary DNA:RNA hybrid 7. transcription rate ( 50 to 90 nts/sec) 8. RNA polymerase has complete processivity

7. RNA Polymerase X-ray studies reveal a “hand” X-ray studies reveal a “hand” Core enzyme closed Core enzyme closed Holoenzyme open Holoenzyme open Suggested mechanism Suggested mechanism NOTE: when sigma leaves, hand is closed NOTE: when sigma leaves, hand is closed RNA polymerase stays on DNA until termination. RNA polymerase stays on DNA until termination.

8. Recognition Template strand Template strand Coding strand Coding strand Promoters Promoters Binding sites for RNA pol on template strand Binding sites for RNA pol on template strand ~40 bp of specific sequences with a specific order and distance between them. ~40 bp of specific sequences with a specific order and distance between them. Core promoter elements for E. coli Core promoter elements for E. coli -10 box (Pribnow box) -10 box (Pribnow box) -35 box -35 box Numbers refer to distance from transcription start site Numbers refer to distance from transcription start site

9. Template and Coding Strands 5’–TCAGCTCGCTGCTAATGGCC–3’ 3’–AGTCGAGCGACGATTACCGG–5’ 5’– UCAGCUCGCUGCUAAUGGCC–3’ Sense (+) strand DNA coding strand Non-template strand DNA template strand antisense (-) strand RNA transcript transcription

10. Typical Prokaryote Promoter Pribnow box located at –10 (6-7bp) Pribnow box located at –10 (6-7bp) -35 sequence ~(6bp) -35 sequence ~(6bp) Consensus sequences: Strongest promoters match consensus Consensus sequences: Strongest promoters match consensus Up mutation: mutation that makes promoter more like consensus Up mutation: mutation that makes promoter more like consensus Down Mutation: virtually any mutation that alters a match with the consensus Down Mutation: virtually any mutation that alters a match with the consensus Consensus sequences

11. Stages of Transcription Template recognition Template recognition RNA pol binds to DNA RNA pol binds to DNA DNA unwound DNA unwound Initiation Initiation Elongation Elongation RNA pol moves and synthesizes RNA RNA pol moves and synthesizes RNA Unwound region moves Unwound region moves Termination Termination RNA pol reaches end RNA pol reaches end RNA pool and RNA released RNA pool and RNA released DNA duplex reforms DNA duplex reforms