1. Chapter 12 DNA and RNA transformation, bacteriophage, nucleotide, base pairing, chromatin, histone, replication, DNA polymerase, gene, messenger RNA, ribosomal RNA, Transfer RNA, transcription, RNA polymerase, promoter, intron, exon, codon, translation, anticodon, mutation, point mutation, frameshift mutation, polyploidy, adenine, cytosine, deletion, guanine, nitrogen base, purine, pyrimidine, thymine, uracil

2. 12-1 DNA Frederick Griffith – 1928 – looking at how mice react to two related pneumonia bacteria Experiment - Rough bacteria – mice live - Smooth bacteria – mice got pneumonia & die - Heat-killed smooth bacteria – mice live - Heat killed smooth + rough bacteria – mice got pneumonia & die 12-1 DNA

3. Figure 12–2 Griffith’s Experiment Disease-causing bacteria (smooth colonies) Harmless bacteria (rough colonies) Heat-killed, disease- causing bacteria (smooth colonies) Control (no growth) Heat-killed, disease-causing bacteria (smooth colonies) Harmless bacteria (rough colonies) Dies of pneumoniaLives Live, disease-causing bacteria (smooth colonies) Dies of pneumonia 12-1 DNA

4. Results = heat killed smooth bacteria could pass on their trait to harmless strain… called transformation Oswald Avery – 1944 – repeated Griffith’s exp. and found thatDNA was the transforming factor Figure 12–2 Griffith’s Experiment 12-1 DNA

5. Alfred Hershey & Martha Chase – 1952 – worked with bacteria and virus to find out if protein or DNA held genes Virus = DNA/RNA surrounded by a protein coat Bacteriophage = a virus that infects bacteria Experiment - Radioactive marker attached to protein part of bacteriophage… infects bacteria… marker was seen outside of bacteria - Radioactive marker to DNA…infection… marker was seen inside bacteria 12-1 DNA

6. Figure 12–4 Hershey-Chase Experiment Bacteriophage with phosphorus-32 in DNA Phage infects bacterium Radioactivity inside bacterium Bacteriophage with sulfur-35 in protein coat Phage infects bacterium No radioactivity inside bacterium Results = genetic material of bacteriophage was DNA 12-1 DNA

7. Components and Structure of DNA Nucleotides = units (monomers) that make up DNA molecule Made of 3 parts: - deoxyribose – a 5-carbon sugar - a phosphate group - a nitrogenous base 12-1 DNA

8. 4 possible nitrogenous bases - purines: Adenine or Guanine - pyrimidines: Cytosine or Thymine PurinesPyrimidines AdenineGuanine CytosineThymine Phosphate group Deoxyribose 12-1 DNA

9. Erwin Chargaff – studied amounts of nitrogenous bases in DNA % guanine equal to % cytosine % adenine equal to % thymine also known as base pairing rule: A=T and C=G Hydrogen bonds Nucleotide Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) 12-1 DNA

10. Rosalind Franklin – 1952 – X-ray diffraction to get pattern from structure of DNA James Watson & Francis Crick – 1953 – published model and paper on DNA structure as a double helix double helix is similar to a twisted ladder or spiral staircase - deoxyribose and phosphate make up sides/backbone - nitrogenous base makes up stairs/rungs 12-1 DNA

11. 12-2 – Chromosomes and DNA Replication Prokaryotes = generally circular strand of DNA in cytoplasm Eukaryotes = multiple molecules of DNA in nucleus Chromosome E. coli bacterium Bases on the chromosome

12. Chromosome structure Chromatin = DNA that is tightly packed around proteins called histones - during cell division, chromatin form packed chromosomes Chromosome Supercoils Coils Nucleosome Histones DNA double helix 12-2 Chromosomes and DNA Replication

13. DNA Replication Replication = process of copying DNA - occurs during S phase of Interphase - process: 1. DNA is separated into two strands by an enzyme 2. free nucleotides are added by DNA polymerase according to base pairing rule 12-2 Chromosomes and DNA Replication

14. DNA Replication Nitrogenous bases Growth Replication fork DNA polymerase New strand Original strand DNA polymerase Replication fork Original strand New strand 12-2 Chromosomes and DNA Replication

15. 12-3 RNA and Protein Synthesis RNA structure Has ribose as a sugar instead of deoxyribose Is generally single-stranded Has uracil instead of thymine 12-3 RNA and Protein Synthesis

16. Types of RNA All types control protein synthesis in a cell 3 main types - mRNA = messenger RNA – copies of instructions from DNA - rRNA = ribosomal RNA – part of ribosomes - tRNA = transfer RNA – transfers amino acids to ribosome 12-3 RNA and Protein Synthesis

17. fromtoto make up also calledwhich functions toalso called which functions to can be RNA Messenger RNA Ribosomal RNA Transfer RNA mRNACarry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome DNARibosomeRibosomes 12-3 RNA and Protein Synthesis

18. RNA Decoding Chart 12-3 RNA and Protein Synthesis

19. Figure 12–14 Transcription Transcription = process of copying part of nucleotide Sequence of DNA into a complementary strand of RNA run by enzyme called RNA polymerase RNA DNA RNA polymerase Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) 12-3 RNA and Protein Synthesis

20. The Genetic Code Proteins are chains of amino acids - 20 different amino acids - the order or sequence of amino acids determines properties of the protein - codon = 3 consecutive nucleotides that specify a single amino acid - one amino acid can have multiple codons AUGGGCUCCAUCGGCGCAUAA mRNA start codon codon 2codon 3codon 4codon 5codon 6codon 7codon 1 12-3 RNA and Protein Synthesis

21. Translation Translation = the decoding of an mRNA message into a polypeptide chain (protein) Occurs on ribosomes 12-3 RNA and Protein Synthesis

22. Process: - mRNA binds to ribosome - tRNA brings appropriate amino acid to ribosome – tRNA has anticodon that is complementary to codon onmRNA; begins with specific start codon - AUG - peptide bonds are made between amino acids - assembly line continues until a stop codon 12-3 RNA and Protein Synthesis

23. Why bother? Transcription and translation keep master plans (DNA) safe in the nucleus, while blueprints (RNA) are sent to the worksite (ribosomes) Proteins are needed to act as enzymes that produces the color of your skin, the type of blood cell, the rate of growth 12-3 RNA and Protein Synthesis

24. 12-4 Mutations Mutation = a change in the genetic material Point mutations = change in one or a few nucleotides Frameshift mutations = adding or deleting a nucleotide… very disruptive 12-4 Mutations

25. Chromosomal Mutations Deletion Duplication Chromosomal mutations = change in the number or structure of chromosomes. - Deletion = loss of all or part of a chromosome - Duplication = produce extra copies of parts of chromosome 12-4 Mutations

26. - Inversion = reverse direction of parts of chromosome - Translocation = part of one chromosome breaks and attaches to another - Polyploidy = an organism has an extra sets of chromosomes Inversion Translocation 12-4 Mutations