2. Chapter 12: Molecular Genetics DNA structure DNA structure Replication Replication Protein synthesis Protein synthesis

3. DNA: The Genetic Material Section 1 – p. 329

4. Essential Questions DNA 1.What is DNA? Chargaff’s 2.Describe Chargaff’s base pairing rules? chromosome 3.Compare the structure of a eukaryotic chromosome with prokaryote DNA. genes 4.How are genes, chromosomes and DNA related?

5. The “OLD” people of DNA 1.Fredrick Griffith 2.Oswald Avery 3.Hershey and Chase 4.Erwin Chargaff 5.Watson and Crick

6. Fredrick Griffith-1928  In 1928, British scientist Fredrick Griffith was trying to learn how certain types of bacteria caused pneumonia.  He isolated two different strains of pneumonia bacteria from mice and grew them in his lab.  Performed the first major experiment that led to the discovery of DNA as the genetic material

7. So Griffith, Avery, Hershey and Chase all helped discover DNA and the importance that it plays in transferring Genes. But what is DNA??? what is it made of??? what does it look like??????

8. What is DNA? 1.A genetic code nucleotides 2.A molecule made of subunits called nucleotides double helix 3.A complex molecule that is arranged as a double helix.

9. NUCLEOTIDES are repeating subunits (monomers) that include: Phosphate group 5-Carbon sugar Nitrogen base

10. NUCLEOTIDES the smallest subunit of DNA

11. Two Kinds of bases in DNA  Pyrimidines are single ring bases.  Thymine & Cytosine  Purines are double ring bases.  Adenine & Guanine Memory trick “Y” are you single?

12. A G C T

13. Erwin Chargraff-  Analyzed the amounts of A, C, T, and G in DNA; Discovered A=T & C=G

14. The Shape of DNA  DNA often is compared to a twisted ladder.  Rails of the ladder are represented by the alternating deoxyribose and phosphate.  The pairs of bases (cytosine–guanine or thymine–adenine) form the steps.

15. Watson and Crick  Built a model of the double helix that conformed to the others’ research  1. two outside strands consist of alternating deoxyribose and phosphate  2. cytosine and guanine bases pair to each other by three hydrogen bonds  3. thymine and adenine bases pair to each other by two hydrogen bonds

16. Watson and Crick  suggested the structure for DNA and Hypothesized a method of replication

17. Refer to the DNA handout Phosphate groups P 1.Locate the Phosphate groups (small circles). Label each one with “P” orange 2.Color all phosphate groups orange deoxyribose sugar 3.Locate the deoxyribose sugar molecules (large pentagon shapes attached to the P’s). Label them by name. blue 4.Color all sugars blue

18. Refer to the DNA handout 1.Locate the nitrogen bases. Label the first base by name and the others “NB”. 2.What do you notice about these molecules?

19. 4 Nitrogen Bases Purines are larger bases Pyrimidines are smaller bases Adenine Thymine Guanine Cytosine

20. Refer to the DNA handout 1.Locate the nitrogen bases – 2 large, 2 small Adenine 2.Label one of the large bases Adenine Guanine 3.Label the other large base Guanine Thymine 4.Label one of the smaller bases Thymine Cytosine 5.Label the other small base Cytosine 6.Color each base a different color.

21. CHARGAFF’S BASE CHARGAFF’S BASE PAIRING RULES PAIRING RULES A binds with T G binds with C

22. Hydrogen Bonds Fig. 4. Adenine-Thymine base pair with two hydrogen bounds. Fig. 5. Guanine-Cytosine base pair with three hydrogen bounds C = Carbon = grayN = Nitrogen = blueO = Oxygen = red

23. 3-D Animation of DNA http://www.umass.edu/molvis/tutorials/dna/dnapairs.htm

24. Stop & Review 1.What is the smallest subunit of DNA? 2.List 3 parts to #1? 3.What are the side chains of DNA made of? 4.What are the “steps” of DNA made of? 5.What are the base pairing rules of DNA? 6.Describe the structure of DNA in 2 words.

25. ANSWERS 1.Nucleotide 2.Sugar, phosphate and a nitrogen base 3.Sugar and phosphate 4.Nitrogen base 5.A=T, C=G 6.Double Helix

26. Comparing eukaryote & prokaryote DNA PROKARYOTE Circular EUKARYOTE Linear

27. genes How are genes, chromosomes and DNA related? Genes are portions of DNA that are tightly packed into chromosomes and code for the manufacture of proteins.

28. genes How are genes, chromosomes and DNA related? Think of chromosomes as socks and genes as stripes on the socks.

29. Place in order from smallest to largest. Gene DNA Chromosomes

30. Vocabulary Clarification CHROMATIN CHROMOSOME

32. Have Your DNA & eat it too! 1.Collect materials 2.Follow instructions pink green *A (pink) pairs with T (green) orange yellow *C (orange) pairs with G (yellow)

33. Semi-conservative replication Part 2

34. Essential Questions replication What is replication and how is it done? helicaseDNA polymerase What’s the role of the enzymes helicase and DNA polymerase?

35. Replication  A complete copy of the DNA is made The DNA code is in the middle of the helix, so how does it get copied if it’s obscured by the side chains and twist of the helix shape?

36. Replication  DNA replication is an important part of the cell division process.  Before a cell divides, it first duplicates its DNA so that the new cell will have the same genetic information.  The specific base pair matching during replication ensures that exact DNA copies are made.

37. The DNA code is in the middle of the helix, so how does it get copied if it’s obscured by the side chains and twist of the helix shape?

38. Replication helicase replication fork 1.Enzymes (helicase) will “unzip” or unwind the double helix by weakening H-bonds creating a replication fork where the two chains separate 2.DNA polymerase 2.DNA polymerase assembles new DNA using each original strand as a template 3.The replicated DNA is proofread and mistakes are edited Replication

39. Replication fork

40. Boring person explaining

41. Replication is discontinuous Okazaki fragments  Short fragments of DNA called Okazaki fragments are added near the replication fork DNA polymerase  Then gaps are filled in by DNA polymerase  Bases are added following the base pairing rules (A-T, C-G) * The lengths of Okazaki fragments are between 1,000 to 2,000 nucleotides long in bacteria and are generally between 100 to 200 nucleotides long in eukaryotes.

42. Copy the following sequence to your foldable. T--A--C--A--A--A--C--T--T--A--C--T----A--T--G--T--T--T--G--A--A--T--G--A Remember that H-bonds hold complementary bases together

43. Unzip sequence to your foldable. TACAAACTTACTATGTTTGAATGA Helicase Step 1: Helicase enzyme “unzips” double helix by weakening H-bonds

44. Using the original DNA sequence on the foldable make a copy. TACAAACTTACTATGTTTGAATGA DNA polymerase Step 2: DNA polymerase enzyme adds DNA bases to the exposed nucleotides on the leading strand ATGTTTGAATGA

45. Using the original DNA sequence on the foldable make a copy. TACAAACTTACTATGTTTGAATGA Okazaki fragments While Okazaki fragments are added on the lagging strand ATGTTTGAATGA ACA AC ACT

46. Using the original DNA sequence on the foldable make a copy. TACAAACTTACTATGTTTGAATGA Polymerase Step 3: Polymerase also proofreads and edits any gaps ATGTTTGAATGATACAAACTTACT

47. RESULTS  TWO strands of identical DNA  DNA replication is known as semiconservative meaning each DNA molecule contained one original strand an one new strand.

49. Have Your DNA & eat it too! 1.Now replicate the DNA, using 2 more pieces of licorice but use black sticks

50. 3-2-1 3 steps cells undergo in replication 2 words meaning the structure of DNA 1 word for duplicating cell DNA

51. Protein synthesis Part 3

52. Warm-Up Quiz: DNA 101 1.DNA is a double stranded sequence of ___________ (smallest unit of DNA). 2.DNA is a code of instructions for building ___________ (molecule). 3.DNA is stored in the _________ (control center of the cell). 4.The DNA code must be transmitted to the ___________ where proteins are built. Today we’ll see how this happens.

53. Essential Questions 7.What is the primary function of DNA? 8.How do RNA and DNA compare? 9.What are the three main types of RNA? What are their roles? 10.How do the base-pairing rules for RNA compare to the rules for DNA? 11.Describe the roles of DNA and RNA in the overall process of protein synthesis.

54. The role of DNA is to store and transmit genetic information

55. How do DNA & RNA compare? RNA Ribose sugar & phosphate “backbone” URACIL replaces thymine Single-stranded, globular, hairpin (huh? Hairpin???) DNA Deoxyribose sugar & phosphate “backbone” N-bases: A, C, G, T Double helix

56. Check your understanding… D ecide with your partner whether the following describes DNA or RNA: 1.Master Plan 2.Blueprint copy 3.Stays in nucleus 4.Goes to ribosome 5.Involves Thymine 6.Involves Uracil 7.Single-stranded 8.Double-stranded 9.Involves codons 10.Polymerase

57. Types of RNA Messenger RNA (mRNA) The original DNA code is transcribed then carried from the nucleus to the ribosome. codons mRNA is written in the form of codons.

58. Types of RNA Transfer RNA (tRNA) anticodon The anticodon that matches the codon found on mRNA. It transfers an amino acid in order to assemble a protein chain.

59. Types of RNA Ribosomal RNA (rRNA) RNA & proteins that make up ribosomes where proteins are made.

60. Base Pairing in DNA vs. RNA RNA A - Uracil C - G DNA A - T C - G

61. PROTEIN SYNTHESIS Step 1 Transcription Step 2 Translation

62. Step 1: TRANSCRIPTION  DNA is changed into a different form of nucleic acid called RNA (ribonucleic acid) codon  The new code is “read” 3 nucleotides at a time called a codon  Occurs in the nucleus Why? Because mRNA can leave the nucleus whereas DNA cannot.

63. TRANSCRIPTIO N 1.Enzymes unzip helix 2.RNA polymerase 2.RNA polymerase assembles mRNA nucleotides but base pairing rules changes slightly a.Thymine in DNA pairs with Adenine Uracil b.Adenine in DNA pairs with Uracil c.Cytosine still pairs with Guanine

64. T - - A - - C - - A - - C - - T - - G - - A - - DNA U A C A A A C U U U G A mRNA A T G T T T G A A A C T Copy the following DNA sequence. Write the complementary nucleotide sequence. Slide  - - A - - T - - G - - T - - G - - A - - C - - T Write the complementary codon sequence. Helicase Step 1: Helicase enzyme “unzips” double helix by weakening H-bonds RNA polymerase Step 2: RNA polymerase enzyme forms complementary mRNA strand

65. Step 2: TRANSLATION  The language of DNA is translated into the language of amino acids  Occurs in the cytoplasm on a ribosome

66. TRANSLATION 1.The mRNA travels to the ribosome where each codon is read anticodon 2.The codon of mRNA matches an anticodon on tRNA 3.When the codon and anticodon match the amino acid being carried by the tRNA is transferred to a growing protein chain.

67. Let’s use your foldable from before. A T G T G A C T DNA U A C A C U G A mRNA  Open the foldable and translate the mRNA code into the correct amino acid sequence.

69. The translation… A T G T G A C T DNA U A C A C U G A mRNA Leucine Lysine Tyrosine STOP

70. Central Dogma of Biology DNA codes for RNA, which guides the synthesis of proteins. DNA  RNA  Protein 1.DNA is unzipped 2.RNA polymerase uses DNA as a template for making mRNA (Uracil is incorporated instead of thymine) 3.mRNA moves out of nucleus to ribosome 4.tRNA carries amino acids to ribosome where they are assembled into a peptide chain 5.Upon reading a STOP codon, the complete protein chain is released

71. Now consider this… 1.On a sheet of paper, write the word CATS. 2.Try rearranging the letters to form as many 3-letter words as you can. 3.Write each word on your paper, and then add a definition for each word. 4.Did any of the codes you formed have the same meaning?

72. The DNA Alphabet Like CATS, there are only 4 nitrogen bases in the DNA alphabet. codonsLike the CATS activity, DNA “words” are only 3-letters. These triplet base sequences are called codons.

73. How many codons can be made using the four letters of the four different bases? Hint:  A codon is made up of 3 nucleotides.  So there are 3 spots and a possibility of 4 bases in each. 4 bases x 4 bases x 4 bases = 64 possible codon combinations. Since the nitrogen base is the only unit to change, the sequence of bases makes up the code. BRAIN TEASER

74. How is DNA like Morse code?

76. It is a series of single repeating units (sounds or symbols) that make up a message. The repeating units are the nucleotides of the DNA molecule. The message is the final protein that is produced. Proteins can be structural, enzymatic, hormones, etc.