1. Fig. S1a-i: MS 2 spectra of infection markers The putative identity of infection markers obtained by metabolite fingerprinting was confirmed by MS 2 fragmentation experiment by LC 1290 Infinity coupled with a 6540 UHD Accurate-Mass Q-TOF LC MS instrument with Agilent Jet Stream Technology as ESI source. m/z 359.1474 Lariciresinol glucoside (M+FA-H + ) - [M-H + ] - [M-H + +FA] - [M-Glc-H + ] - [M-Glc-CH 2 O-H + ] - [M-Glc-C 9 H 12 O-H + ] - 359.1474 - 162.0528, C 6 H 10 O 5 - 136.088, C 9 H 12 O - 30.0196, CH 2 O - 164.0825, C 10 H 12 O 2 195.0649 m/z 195.065 [C 10 H 11 O 4 ] - Supporting Information Figure S1a

2. [M-Glc-Glc-H + ] - [M-Glc-Glc-CH 2 O-H + ] - [M-H + ] - [M-H + +FA] - Lariciresinol diglucoside (M+FA-H + ) - [M-Glc-H + ] - - 162.0528 Da, C 6 H 10 O 5 - 2 x 162.0528 Da, C 12 H 20 O 10 - 30.0196 Da, CH 2 O Supporting Information Figure S1b m/z 359.1491 m/z 521.2001

3. Pinoresinol glucoside [M+FA-H + ] - - 162.0528, C 6 H 10 O 5 [M-H + ] - [M-Glc-H + ] - Supporting Information Figure S1c m/z 357.1343

4. - 2 x 162.0528, 2 x C 6 H 10 O 5 - 206.0942, C 12 H 14 O 3 [X] Pinoresinol diglucoside [M+FA-H + ] - [M-Glc-Glc-H + ] - [M-H + ] - [M-Glc-H + ] - [M-Glc-Glc-H + ] - Supporting Information Figure S1d x m/z 357.1338 [C 8 H 7 O 3 ] - [X] - m/z 151.0398 (X - ) m/z 519.1859

5. Supporting Information Figure S1e Syringaresinol glucoside [M-H + ] - [M-Glc-H + ] - [M-H + ] - - 162.0528, C 6 H 10 O 5 - 236.1051, C 13 H 16 O 4 [C 9 H 9 O 4 ] - [Y] - m/z 417.1555 Y m/z 181.0504 [Y] -

6. Supporting Information Figure S1f Guaiacylglycerol ferulic acid ether glucoside [M-H + ] - - 48.0216, -H 2 O - CH 2 O - 162.0528, - C 6 H 10 O 5 - 196.0735, - C 10 H 12 O 4 [M-Glc-H + ] - [M-H + ] - - 196.0735 -27.9938,- CO - C 10 H 12 O 4 Ferulic acid [C 10 H 9 O 4 ] - m/z 193.0504 m/z 389.1239 m/z 165.0566 [C 9 H 9 O 3 ] -

7. Supporting Information Figure S1g [M-H + ] - [M-Glc-H + ] - [M-Glc-CH 2 O-H + ] - [M-Glc-H 2 O-H + ] - - 162.0528, C 6 H 10 O 5 - 30.0103, CH 2 O - 18.0096, H 2 O Sesamolinol glucoside [M-H + ] - 341.1010 m/z 371.1105 m/z 341.1010

8. Supporting Information Figure S1h 341.1009 [M-H + ] - [M-Malyl-H + ] - [M-Malyl-CH 2 O-H + ] - [M-Malyl-H 2 O-H + ] - - 116.0114, C 4 H 4 O 4 - 30.0103, CH 2 O - 18.0096, H 2 O Malyl sesamolinol [M-H + ] - m/z 371.1105 m/z 341.1009

9. Supporting Information Figure S1i Scopolin [M+FA-H + ] - [M-H + +FA] - [M-Glc-H + ] - [M-Glc-CH 3 -H + ] - - 162.0528 -44.9898, C 6 H 10 O 5 -FA - 15.0227, -CH 3 m/z 176.0120 m/z 191.0347

10. (a) (b) Supporting Information Figure S2 intensity valine (cl.11) glutamine (cl.12) arginine (cl. 14) asparagine (cl. 11) 35dpi21 dpi10 dpi control VL control VL control VL 10 dpi21 dpi 35dp i control VL control VL control VL 10 dpi 21 dpi 35dpi 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 pyrrolidone-5-carboxylic acid (cl. 12) leucine (cl. 10) Fig. S2: UPLC-TOF-MS based metabolite fingerprinting of V. longisporum infected Arabidopsis leaves. Arabidopsis plants of different time points after inoculation with V. longisporum (10, 21 and 35 dpi) and the corresponding control plants were harvested and the aerial parts were extracted by two phase partitioning. The fingerprint of metabolites of the polar extraction phase was generated by UPLC-TOF-MS analysis. A subset of high-quality 862 metabolite marker candidates (FDR <10 -4 ) derived from the positive as well as the negative ionization mode were used for clustering and visualization by means of one- dimensional self-organizing map (1D-SOM). (a) 1D-SOM heat map after metabolite- based clustering with 20 prototypes. Horizontal and vertical dimensions correspond to prototypes and experimental conditions, respectively. The heat map colors represent average intensity values according to the color map on the right hand side. The width of each prototype column is proportional to the number of marker candidates assigned to this prototype. (b) Box plots of prominent markers from different clusters (cl.) which accumulate in V. longisporum inoculated plants (VL). Four samples per treatment from two independent experiments were analyzed. Boxes indicate the 25 th (q1) and 75 th (q3) intensity percentiles and median of the data. The whiskers indicate the range between q1- 1.5(q3-q1) and q3+1.5(q3-q1), respectively.

11. control VL43 hypocotyl petiole Supporting Information Figure S3 Fig. S3: Lignin accumulation in V. longisporum infected vascular tissue of Arabidopsis. Cross-sections of hypocotyls and petioles of V. longisporum inoculated (VL) and control plants at 21 dpi. Material was paraffin embedded, hand sectioned and stained with phloroglucin/HCl for lignified tissue. Scale bar: 200 µm.

12. ABC relative leaf areaVL-DNA control Col 0 C4H:F5H VL Supporting Information Figure S4 Fig. S4: Infection of the C4H:F5H mutant with V. longisporum. Col 0 and C4H:F5H plants were infected by root dip infection and harvested at 21 dpi. (a) Pictures of infected and control plants at 21 dpi. (b) The relative leaf area was determined from pictures taken of the rosettes of the plants: The leaf area of infected plants was divided by the leaf area of control plants and the results of the mutant plants were set in relation to the value of the wild type. The data represent the mean values of five independent experiments ±SD. (c) Determination of VL-DNA in infected leaves. The mean values of ten samples of three independent experiments are shown ±SE.

13. Supporting Information Figure S5 Fig. S5: Sinapoyl glucose, coniferin and syringin in glycosyltransferase overexpressor plants and the fah1-2 mutant. Quantification of sinapoyl glucose and monolignols by HPLC-DAD of V. longisporum-inoculated (black bars) and control (white bars) plants. Syringin could not be quantified in the UGT72E2-OE because of high coniferin peaks. Each data point represents the mean value of eight samples from two independent experiments + SD. (*, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001 ) syringin coniferin UGT72E3-OE UGT72E2-OE UGT72E1-OE Col 0 fah1-2 sinapoyl glucose Col 0 fah1-2 control VL UGT72E3-OE UGT72E2-OE UGT72E1-OE Col 0 UGT72E3-OE UGT72E2-OE UGT72E1-OE Col 0 coniferin sinapoyl glucose n.d.

14. Fig S6: Influence of ferulic and sinapic acid on V. longisporum growth. PDB plates were supplemented with ferulic acid and sinapic acid in the indicated concentrations. After inoculation the fungus was grown for 18 days on the plates. Pictures of colonies were taken under a binocular and the colony area was determined. The data represent the mean values ±SD of seven different plates of two independent experiments. Asterisks indicate significant differences between control and supplemented plates according to student’s t-test (*, P ≤ 0.05; ***, P ≤ 0.001). Supporting Information Figure S6 ferulic acid sinapic acid *** *

15. Supporting Information Table S1 Table S1: Primers used for the quantitative RT-PCR. QuantPrime: Samuel Arvidsson, Miroslaw Kwasniewski, Diego M. Riano-Pachon and Bernd Mueller- Roeber: QuantPrime - a flexible tool for reliable high-throughput primer design for quantitative PCR. BMC Bioinformatics 2008, 9:465 nameATGPrimerreference Phenylalanine ammonia lyase 1 (PAL1) At2g37040 PAL1neuF: AGAAGTGGAAGCAGCAAGAGCAG PAL1neuR: ATCCTGTTCGGGATAGCCGATG QuantPrime Phenylalanine ammonia lyase 2 (PAL2) At3g53260 PAL2R: TGCTACTTCTCACCGGAGA PAL2F: TATTCCGGCGTTCAAAAATC Huang et al. 2010 Ferulate-5- hydroxylase (F5H) At4g36220 F5H_F: ATGATGGGGATGTTGTCGAT F5H_R: CGTCCATGATGATTGCTTTG Vanholme et al. 2010 Cinnamyl alcohol dehydrogenase 5 (CAD5) At4g34230 CAD5F: CCTGCGAGAGAGATCTGGAA CAD5R:CAAAGTGGCTCAGTGGACTGT Tronchet et al. 2010 Cinnamyl alcohol dehydrogenase 8 (CAD8) At4g37990 CAD8F: GCTGCACCGAAGGTATGGAA CAD8R: CGTCCAAGGGGAGATTGTCT Tronchet et al. 2010 UGT72E1At3g50740 72E1F: AAAGAGACCGCTGCCGAAT 72E1R: CCTGACACGCTCCAAAAGATG Lanot et al. 2006 UGT72E2At5g66690 72E2neuF: TGGTGGTTGTCTATCGGCGAAAC 72E2neuR: ATACGAACCGTTGCTGGCTCTG QuantPrime UGT72E3At5g26310 72E3neuF: AGGGTTCGTGACTCGTACTTGC 72E3neuR: TGGGCTAGGATTTCAGCTTGCG QuantPrime UGT84A3At4g15490 84A3F: AGCCAACTTGAAGCAAGAGCAG 84A3R: ACCACCCATAAGACCGACAAGC QuantPrime Dirigent protein 6 (DIR6) At4g23690 DIR6F: ACCCTGCAAACACTTCTCGTTC DIR6R: CGGAGGTTGCGTTTGCTACATTG QuantPrime

16. Supporting Information Table S2 Table S2: Data matrix of 826 high quality marker candidates (false discovery rate<10 -4 ) obtained by metabolite fingerprinting (UPLC-ESI-TOF-MS analysis) of mock treated (control) or V. longisporum infected (VL) leaves of Arabidopsis (10, 21, 35 dpi) (see separate file).

17. Supporting Information Table S3 Table S3: Infection markers identified by metabolite fingerprinting (UPLC-ESI-TOF-MS analysis) and verified by UHPLC-ESI-QTOF-MS 2 analysis or co-elution (see separate file).

18. LinieAtgplant lineliteratureeffected genesusceptibility fah1-2At4g36220CS6172(Chapple et al. 1992) ferulate-5-hydroxylase defect ++ ref 1_SALKAt3g24503SALK_027911 aldehyde- dehydrogenase defect (+) sng1-1At3g24503N3737(Lorenzen et al. 1996) sinapoylglucose- malate O- sinapoyltransferase defect (+) UGT72E1-OEAt3g50740(Lanot et al. 2008) glycosyltransferase overexpressed +/- UGT72E2 -OEAt5g66690(Lanot et al. 2006) glycosyltransferase overexpressed -- UGT72E3 -OEAt5g26310(Lanot et al. 2008) glycosyltransferase overexpressed +/- C4H::F5HAt4g36220(Meyer et al. 1998) ferulate-5-hydroxylase overexpressed (- ) Atprr1-1atprr2 At1g32100 At4g13660 SALK_058467 SALK_123621 (Nakatsobu et al. 2008) pinoresinol-reductase defect +/- nac42At2g43000N536474 transcription factor defect +/- NAC42_20-OEAt2g43000 transkription factor overexpressed +/- NAC42_6 -OEAt2g43000 transcription factor overexpressed +/- cad4At4g39330SAIL_1265_A06 cinnamyl-alcohol- dehydrogenase defect +/- cad5At4g34230SALK_040062cinnamyl-alcohol- dehydrogenase defect +/- Supporting Information Table S4 Table S4: Mutants and transgenic lines tested for their susceptibility against V. longisporum.