1. What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale

2. Microarray

4. ATATCGGCATCAGTCGATCGATCATCGATCGAT UAUAGCCGUAGUCAGCUAGCUAGUAGCUAGCUA ATATCGGCATCAGTCGATCGATCATCGATCGAT DNA mRNA cDNA DNARNAProtein Transcription Reverse transcription Translation Replication

6. What Is Microarray Different Approaches Stanford/ Synteni Affymetrix How DNA sequences are laid down SpottingPhotolithography Length of DNA sequences cDNA(Complete sequences) Oligonucleotides

7. Affymetrix Probe Array (Photolithography) Synthesis of probe Hybridization

8. Stanford Approach Use robot to spot glass slides Able to measure qualitatively relative expression levels of genes Differential expression by use of simultaneous, two-color fluorescence hybridisation Cheaper with DIY ($60,000) Also called home-made system

9. Life Cycle(cont.) Cy3 (green) Cy5 (red)

10. Procedures Preparation Target DNA (reference and test samples) Slides Reaction(Droplet or Pin Spotting) Hybridization Scanning Analysis Image processing Data mining Modeling Arrayer Scanner Hardware Software

11. Instruments Arrayer Scanner Laser Confocal Microscope

12. Arrayer

13. Scanner GenPix 4000

17. Problems – by direct view Anti-probe Locally high background Spot overlap Precipitate Locally low signal Comet-tails (donut hole)

18. Problems – related wit IP Local problems Spot position variation Spot shape and size irregularity Spot Overlapping Global problems High background Low signal White-noise/Speckle effect (Contamination)

19. Array Alignment Good Alignment Bad Alignment

20. Spot Finding Grid System Determination Manual Semiautomatic Automatic Spot Segmentation Space-based Intensity-based Frequency-based Hybrid approach

21. Grid System Determination

22. Spot Segmentation

23. Spot Segmentation(cont.)

24. Applications Gene expression studies Gene function for cell state change in various conditions Disease Diagnosis Pathogen Analysis

25. Applications(Cont.) Drug Discovery identify appropriate molecular targets for therapeutic intervention monitor changes in gene expression in response to drug treatments Trageted Drug Treatment

26. Example Images – E. Coli

27. Example Images – C. Elegan

29. 1.75 ….. Log(R/G) ….. Gene index

30. ….. Log(R/G ) ….. Log(R/G ) ….. Log(R/G ) ….. …

31. N gene M experiments …..